ID: 1031247189

View in Genome Browser
Species Human (GRCh38)
Location 7:119329296-119329318
Sequence TAAGCTCTGTTAACAACAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031247187_1031247189 21 Left 1031247187 7:119329252-119329274 CCAGCAACATGTCCTTGGTGAAA No data
Right 1031247189 7:119329296-119329318 TAAGCTCTGTTAACAACAGTTGG No data
1031247188_1031247189 9 Left 1031247188 7:119329264-119329286 CCTTGGTGAAAATGAGCAAGACA No data
Right 1031247189 7:119329296-119329318 TAAGCTCTGTTAACAACAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031247189 Original CRISPR TAAGCTCTGTTAACAACAGT TGG Intergenic
No off target data available for this crispr