ID: 1031247703

View in Genome Browser
Species Human (GRCh38)
Location 7:119337730-119337752
Sequence CTATCCAGCTAAAACAGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031247703_1031247705 16 Left 1031247703 7:119337730-119337752 CCCTTACTGTTTTAGCTGGATAG No data
Right 1031247705 7:119337769-119337791 AATTACATTCAAACTCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031247703 Original CRISPR CTATCCAGCTAAAACAGTAA GGG (reversed) Intergenic
No off target data available for this crispr