ID: 1031250536

View in Genome Browser
Species Human (GRCh38)
Location 7:119374631-119374653
Sequence GACCATATGTTGCTTTTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031250536_1031250537 0 Left 1031250536 7:119374631-119374653 CCATTGAAAAGCAACATATGGTC No data
Right 1031250537 7:119374654-119374676 TTTCAATATGTCCAATACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031250536 Original CRISPR GACCATATGTTGCTTTTCAA TGG (reversed) Intergenic
No off target data available for this crispr