ID: 1031251704

View in Genome Browser
Species Human (GRCh38)
Location 7:119391039-119391061
Sequence AATTTCTACATGAGTATTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031251699_1031251704 -4 Left 1031251699 7:119391020-119391042 CCCGCCACCTTGATTACTAAATT No data
Right 1031251704 7:119391039-119391061 AATTTCTACATGAGTATTGGAGG No data
1031251701_1031251704 -8 Left 1031251701 7:119391024-119391046 CCACCTTGATTACTAAATTTCTA No data
Right 1031251704 7:119391039-119391061 AATTTCTACATGAGTATTGGAGG No data
1031251697_1031251704 8 Left 1031251697 7:119391008-119391030 CCTCTTAATGGCCCCGCCACCTT No data
Right 1031251704 7:119391039-119391061 AATTTCTACATGAGTATTGGAGG No data
1031251700_1031251704 -5 Left 1031251700 7:119391021-119391043 CCGCCACCTTGATTACTAAATTT No data
Right 1031251704 7:119391039-119391061 AATTTCTACATGAGTATTGGAGG No data
1031251698_1031251704 -3 Left 1031251698 7:119391019-119391041 CCCCGCCACCTTGATTACTAAAT No data
Right 1031251704 7:119391039-119391061 AATTTCTACATGAGTATTGGAGG No data
1031251695_1031251704 20 Left 1031251695 7:119390996-119391018 CCTCATCAATCACCTCTTAATGG No data
Right 1031251704 7:119391039-119391061 AATTTCTACATGAGTATTGGAGG No data
1031251694_1031251704 21 Left 1031251694 7:119390995-119391017 CCCTCATCAATCACCTCTTAATG No data
Right 1031251704 7:119391039-119391061 AATTTCTACATGAGTATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031251704 Original CRISPR AATTTCTACATGAGTATTGG AGG Intergenic
No off target data available for this crispr