ID: 1031265783

View in Genome Browser
Species Human (GRCh38)
Location 7:119578314-119578336
Sequence GTGCCTGTCCAGATACAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031265783_1031265787 6 Left 1031265783 7:119578314-119578336 CCTCCTTGTATCTGGACAGGCAC No data
Right 1031265787 7:119578343-119578365 AATGCCTGCTGGAACAAAGTTGG No data
1031265783_1031265786 -5 Left 1031265783 7:119578314-119578336 CCTCCTTGTATCTGGACAGGCAC No data
Right 1031265786 7:119578332-119578354 GGCACTGGCAAAATGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031265783 Original CRISPR GTGCCTGTCCAGATACAAGG AGG (reversed) Intergenic
No off target data available for this crispr