ID: 1031267039

View in Genome Browser
Species Human (GRCh38)
Location 7:119594103-119594125
Sequence CAGAATAAGAAGAAGAAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031267034_1031267039 27 Left 1031267034 7:119594053-119594075 CCTACTAGCTCACAGTTTAGAAA No data
Right 1031267039 7:119594103-119594125 CAGAATAAGAAGAAGAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031267039 Original CRISPR CAGAATAAGAAGAAGAAGTT GGG Intergenic
No off target data available for this crispr