ID: 1031273700

View in Genome Browser
Species Human (GRCh38)
Location 7:119689411-119689433
Sequence AGATATCTGAAGAAGTTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031273698_1031273700 19 Left 1031273698 7:119689369-119689391 CCTAGAGAAAGAGAGAGTAATGT No data
Right 1031273700 7:119689411-119689433 AGATATCTGAAGAAGTTGAATGG No data
1031273697_1031273700 20 Left 1031273697 7:119689368-119689390 CCCTAGAGAAAGAGAGAGTAATG No data
Right 1031273700 7:119689411-119689433 AGATATCTGAAGAAGTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031273700 Original CRISPR AGATATCTGAAGAAGTTGAA TGG Intergenic
No off target data available for this crispr