ID: 1031287355

View in Genome Browser
Species Human (GRCh38)
Location 7:119886618-119886640
Sequence CAAAATGCTGATAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031287355_1031287358 4 Left 1031287355 7:119886618-119886640 CCCATATCACTATCAGCATTTTG No data
Right 1031287358 7:119886645-119886667 AAGCTATTCAACAAATCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031287355 Original CRISPR CAAAATGCTGATAGTGATAT GGG (reversed) Intergenic