ID: 1031287355 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:119886618-119886640 |
Sequence | CAAAATGCTGATAGTGATAT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1031287355_1031287358 | 4 | Left | 1031287355 | 7:119886618-119886640 | CCCATATCACTATCAGCATTTTG | No data | ||
Right | 1031287358 | 7:119886645-119886667 | AAGCTATTCAACAAATCTGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1031287355 | Original CRISPR | CAAAATGCTGATAGTGATAT GGG (reversed) | Intergenic | ||