ID: 1031289672

View in Genome Browser
Species Human (GRCh38)
Location 7:119917209-119917231
Sequence GAGGGTAAAGAGTGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5588
Summary {0: 6, 1: 46, 2: 436, 3: 1553, 4: 3547}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031289659_1031289672 26 Left 1031289659 7:119917160-119917182 CCACGATGGCTGGAAACACAGAA No data
Right 1031289672 7:119917209-119917231 GAGGGTAAAGAGTGGGAGGAGGG 0: 6
1: 46
2: 436
3: 1553
4: 3547

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031289672 Original CRISPR GAGGGTAAAGAGTGGGAGGA GGG Intergenic
Too many off-targets to display for this crispr