ID: 1031291688

View in Genome Browser
Species Human (GRCh38)
Location 7:119945699-119945721
Sequence TAGGGGATTCAGCATCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031291688_1031291692 -1 Left 1031291688 7:119945699-119945721 CCTTCTTGATGCTGAATCCCCTA No data
Right 1031291692 7:119945721-119945743 ACAATTGACCAGCCTAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031291688 Original CRISPR TAGGGGATTCAGCATCAAGA AGG (reversed) Intergenic
No off target data available for this crispr