ID: 1031293303

View in Genome Browser
Species Human (GRCh38)
Location 7:119967235-119967257
Sequence AAATATCCAGGGTTGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031293294_1031293303 3 Left 1031293294 7:119967209-119967231 CCCCACCCAAGTCTCATATTTAA No data
Right 1031293303 7:119967235-119967257 AAATATCCAGGGTTGGAGAAGGG No data
1031293295_1031293303 2 Left 1031293295 7:119967210-119967232 CCCACCCAAGTCTCATATTTAAT No data
Right 1031293303 7:119967235-119967257 AAATATCCAGGGTTGGAGAAGGG No data
1031293298_1031293303 -3 Left 1031293298 7:119967215-119967237 CCAAGTCTCATATTTAATTGAAA No data
Right 1031293303 7:119967235-119967257 AAATATCCAGGGTTGGAGAAGGG No data
1031293297_1031293303 -2 Left 1031293297 7:119967214-119967236 CCCAAGTCTCATATTTAATTGAA No data
Right 1031293303 7:119967235-119967257 AAATATCCAGGGTTGGAGAAGGG No data
1031293296_1031293303 1 Left 1031293296 7:119967211-119967233 CCACCCAAGTCTCATATTTAATT No data
Right 1031293303 7:119967235-119967257 AAATATCCAGGGTTGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031293303 Original CRISPR AAATATCCAGGGTTGGAGAA GGG Intergenic
No off target data available for this crispr