ID: 1031305387

View in Genome Browser
Species Human (GRCh38)
Location 7:120119664-120119686
Sequence ATGTCCTTCTAAAAGAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031305387_1031305391 18 Left 1031305387 7:120119664-120119686 CCTTCATTCTTTTAGAAGGACAT No data
Right 1031305391 7:120119705-120119727 TCCATGGTTTAGAATAAAAGAGG 0: 17
1: 21
2: 24
3: 47
4: 248
1031305387_1031305389 2 Left 1031305387 7:120119664-120119686 CCTTCATTCTTTTAGAAGGACAT No data
Right 1031305389 7:120119689-120119711 TTTGTTAGGTCCTTTTTCCATGG 0: 39
1: 40
2: 27
3: 29
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031305387 Original CRISPR ATGTCCTTCTAAAAGAATGA AGG (reversed) Intergenic
No off target data available for this crispr