ID: 1031305649

View in Genome Browser
Species Human (GRCh38)
Location 7:120123247-120123269
Sequence TCTTATGCAGAAAAGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031305649_1031305657 26 Left 1031305649 7:120123247-120123269 CCCAGCCCCTTTTCTGCATAAGA No data
Right 1031305657 7:120123296-120123318 CTCCCTATTGCCAGATGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031305649 Original CRISPR TCTTATGCAGAAAAGGGGCT GGG (reversed) Intergenic
No off target data available for this crispr