ID: 1031308146

View in Genome Browser
Species Human (GRCh38)
Location 7:120160088-120160110
Sequence ATACTGTAATTGAGGACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031308146_1031308148 17 Left 1031308146 7:120160088-120160110 CCATGTGTCCTCAATTACAGTAT No data
Right 1031308148 7:120160128-120160150 AAGCCCTAAACAATCCCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031308146 Original CRISPR ATACTGTAATTGAGGACACA TGG (reversed) Intergenic
No off target data available for this crispr