ID: 1031310233

View in Genome Browser
Species Human (GRCh38)
Location 7:120187228-120187250
Sequence TGGATTTTCTAGGAGATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031310227_1031310233 19 Left 1031310227 7:120187186-120187208 CCTTTTGCTCCATAATAAAATGA No data
Right 1031310233 7:120187228-120187250 TGGATTTTCTAGGAGATCCAGGG No data
1031310226_1031310233 20 Left 1031310226 7:120187185-120187207 CCCTTTTGCTCCATAATAAAATG No data
Right 1031310233 7:120187228-120187250 TGGATTTTCTAGGAGATCCAGGG No data
1031310229_1031310233 10 Left 1031310229 7:120187195-120187217 CCATAATAAAATGATAGGTTTCT No data
Right 1031310233 7:120187228-120187250 TGGATTTTCTAGGAGATCCAGGG No data
1031310225_1031310233 21 Left 1031310225 7:120187184-120187206 CCCCTTTTGCTCCATAATAAAAT No data
Right 1031310233 7:120187228-120187250 TGGATTTTCTAGGAGATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031310233 Original CRISPR TGGATTTTCTAGGAGATCCA GGG Intergenic
No off target data available for this crispr