ID: 1031313208

View in Genome Browser
Species Human (GRCh38)
Location 7:120225667-120225689
Sequence TTGTAGACATAGTTGGACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031313208_1031313213 29 Left 1031313208 7:120225667-120225689 CCTAGGTCCAACTATGTCTACAA No data
Right 1031313213 7:120225719-120225741 AAGACCAATAAATTCTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031313208 Original CRISPR TTGTAGACATAGTTGGACCT AGG (reversed) Intergenic
No off target data available for this crispr