ID: 1031313213

View in Genome Browser
Species Human (GRCh38)
Location 7:120225719-120225741
Sequence AAGACCAATAAATTCTCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031313210_1031313213 2 Left 1031313210 7:120225694-120225716 CCTTGCCCTCAAATTCGCAGACA No data
Right 1031313213 7:120225719-120225741 AAGACCAATAAATTCTCTTTTGG No data
1031313211_1031313213 -3 Left 1031313211 7:120225699-120225721 CCCTCAAATTCGCAGACAAAAAG No data
Right 1031313213 7:120225719-120225741 AAGACCAATAAATTCTCTTTTGG No data
1031313209_1031313213 22 Left 1031313209 7:120225674-120225696 CCAACTATGTCTACAATAAACCT No data
Right 1031313213 7:120225719-120225741 AAGACCAATAAATTCTCTTTTGG No data
1031313212_1031313213 -4 Left 1031313212 7:120225700-120225722 CCTCAAATTCGCAGACAAAAAGA No data
Right 1031313213 7:120225719-120225741 AAGACCAATAAATTCTCTTTTGG No data
1031313208_1031313213 29 Left 1031313208 7:120225667-120225689 CCTAGGTCCAACTATGTCTACAA No data
Right 1031313213 7:120225719-120225741 AAGACCAATAAATTCTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031313213 Original CRISPR AAGACCAATAAATTCTCTTT TGG Intergenic
No off target data available for this crispr