ID: 1031323436

View in Genome Browser
Species Human (GRCh38)
Location 7:120362871-120362893
Sequence CAGGGTGAACAGAACCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 646
Summary {0: 1, 1: 0, 2: 5, 3: 72, 4: 568}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031323431_1031323436 -3 Left 1031323431 7:120362851-120362873 CCACCTCTATAGGTTGGATGCAG 0: 1
1: 0
2: 1
3: 2
4: 83
Right 1031323436 7:120362871-120362893 CAGGGTGAACAGAACCAGGAAGG 0: 1
1: 0
2: 5
3: 72
4: 568
1031323429_1031323436 4 Left 1031323429 7:120362844-120362866 CCGTTGACCACCTCTATAGGTTG 0: 1
1: 0
2: 1
3: 9
4: 76
Right 1031323436 7:120362871-120362893 CAGGGTGAACAGAACCAGGAAGG 0: 1
1: 0
2: 5
3: 72
4: 568
1031323434_1031323436 -6 Left 1031323434 7:120362854-120362876 CCTCTATAGGTTGGATGCAGGGT 0: 1
1: 0
2: 0
3: 9
4: 56
Right 1031323436 7:120362871-120362893 CAGGGTGAACAGAACCAGGAAGG 0: 1
1: 0
2: 5
3: 72
4: 568

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031323436 Original CRISPR CAGGGTGAACAGAACCAGGA AGG Intronic
900541776 1:3206539-3206561 GAGGGTGAGCAGACTCAGGAAGG - Intronic
901439716 1:9270519-9270541 CCCGGTGGACAGAACTAGGAGGG - Exonic
901760439 1:11467732-11467754 AAAGGTGAACAGATGCAGGAAGG + Intergenic
902058581 1:13622609-13622631 CAGCTTGCAGAGAACCAGGAAGG - Intergenic
902687699 1:18089592-18089614 CAGTGGGATCAGGACCAGGAAGG + Intergenic
905405803 1:37731642-37731664 AAGGGTGAACAGGAACAGGGAGG + Intronic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
905549553 1:38825316-38825338 GAGTGTGAACAGAACCATGTTGG - Intergenic
905871595 1:41407535-41407557 CAGGGTGAACATGAGAAGGATGG - Intergenic
906579634 1:46925692-46925714 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
906604089 1:47153196-47153218 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
906821180 1:48931922-48931944 CAGGGAGAAGAGCACCAGAATGG - Intronic
907323497 1:53620357-53620379 CAGGGTGAACAGAAAATGGGCGG + Intronic
908378092 1:63566346-63566368 GAGGGTGAAGAGTACGAGGAGGG + Intronic
908584706 1:65555007-65555029 GAGGGTGAGCTGAAGCAGGATGG - Intronic
908592788 1:65651826-65651848 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
908825941 1:68132643-68132665 TAGCGTGAACAGAAATAGGAGGG + Intronic
909787098 1:79627620-79627642 CTGTGTGAATAGAACTAGGATGG - Intergenic
910606339 1:89088831-89088853 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
910649405 1:89549324-89549346 CAGGGTTAATAGAAACATGAAGG - Intronic
910827916 1:91428731-91428753 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
912450941 1:109767370-109767392 CAGGGTGAACAGGATGATGATGG - Intronic
912894948 1:113576453-113576475 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
913102815 1:115584819-115584841 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
913113192 1:115674116-115674138 CAGTGTGAGCAGAAACAGGCTGG - Intronic
913509930 1:119552228-119552250 GAAGGTAAACAGACCCAGGAAGG - Intergenic
915061443 1:153188947-153188969 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
915087429 1:153397938-153397960 CAGGGCAAACTGTACCAGGATGG - Intergenic
916469315 1:165107835-165107857 TGGGGAGAACAGAACCAAGATGG - Intergenic
916731678 1:167572196-167572218 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
917682601 1:177383477-177383499 GAGGGAGAACAGAACCAAGTTGG - Intergenic
918163278 1:181920580-181920602 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
919031649 1:192250732-192250754 CAGGGAGAACAGAAACAAGCTGG - Intergenic
919439742 1:197616999-197617021 CCAGGTGAAGAGAACAAGGAGGG + Intronic
920985508 1:210885255-210885277 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921098745 1:211910331-211910353 CAGGGTGAAGCCAACCAGGAGGG + Intergenic
921631261 1:217437077-217437099 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG + Intergenic
922066129 1:222145642-222145664 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922219027 1:223543854-223543876 CAGGCTGGCCAGATCCAGGACGG - Intronic
922552199 1:226503852-226503874 CAGGGAGAATAGAACCAAGTTGG - Intergenic
922715928 1:227872034-227872056 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922973318 1:229761343-229761365 CAGAGGGAACAGAAACTGGAAGG - Intergenic
923194501 1:231652061-231652083 CAGGGTGAGCCGAAGCAGGGCGG - Intronic
923853345 1:237820368-237820390 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
924829092 1:247573484-247573506 GAGGGTGAACAGAAGCAGGGTGG - Intronic
924883390 1:248187685-248187707 GAGAGTGAGCAGAAGCAGGATGG + Intergenic
1063074724 10:2703250-2703272 CAGGCTGGAAAGAATCAGGAAGG - Intergenic
1063362376 10:5469001-5469023 CAGGGGAAACAGACCCAGGAGGG + Intergenic
1064119821 10:12609041-12609063 CAGGAAGACCAGAACCTGGAAGG - Intronic
1064371109 10:14752188-14752210 CAGGCTGAGCACAAACAGGAAGG - Intronic
1064474191 10:15669117-15669139 CAGGGAGAATAGAACCAAGTTGG - Intronic
1065766642 10:29036543-29036565 CAGAAGGAACAGAAGCAGGAAGG + Intergenic
1066152721 10:32641250-32641272 CAGGGAGAATAGAACCAAGCTGG - Intronic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1066993574 10:42540000-42540022 GAGGGTGAGCCGAAGCAGGATGG - Intergenic
1067785906 10:49247015-49247037 CAGGGAGAATAGAACCAAGTAGG + Intergenic
1068357188 10:55923806-55923828 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1070213086 10:74347277-74347299 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1070349175 10:75575716-75575738 GAGGGTGAGCCGAAGCAGGAGGG + Intronic
1070662189 10:78315001-78315023 CAGGTTGAACAGTAGAAGGAAGG - Intergenic
1070753676 10:78978363-78978385 CAGCGTGAACAAAACCAGGGAGG - Intergenic
1071567924 10:86681110-86681132 CAGGGGGAACAGACACAGAACGG + Intronic
1072493788 10:95934683-95934705 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1072784448 10:98270111-98270133 CCGGGTGAACATAGCCAGGCAGG - Intergenic
1073321041 10:102616464-102616486 CAGAATGAACAGGACCTGGAGGG + Intronic
1073927515 10:108534082-108534104 CAGGGAGAATAGAACCAAGCTGG + Intergenic
1074015463 10:109529867-109529889 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1075860688 10:125674016-125674038 CAGAGAGAACAGAACCAAGTTGG - Intronic
1076270604 10:129149248-129149270 CAGGGTGGAAAAAACCAAGATGG - Intergenic
1076493610 10:130881783-130881805 AAGGGTGAAGACAAGCAGGAAGG - Intergenic
1077018690 11:407902-407924 CAGGGCCAGCAGGACCAGGAGGG + Exonic
1077178033 11:1199416-1199438 CAGTGTGAGAAGCACCAGGATGG + Intronic
1077201613 11:1310114-1310136 CCGGGTGAACGGAACGGGGATGG + Intergenic
1077246334 11:1541026-1541048 CAGTGTGAAGAGACACAGGAAGG + Intergenic
1077508386 11:2942727-2942749 CAGGGTGAACAGTCACAGGAAGG + Intergenic
1078156932 11:8807444-8807466 CGGGGTGTACAGATTCAGGAGGG - Intronic
1078675435 11:13408218-13408240 AATGATGAACAGAACCAGGATGG - Intronic
1079867821 11:25758137-25758159 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080709982 11:34737670-34737692 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1081118198 11:39231917-39231939 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1082558012 11:54585914-54585936 CAGGGAGAATAGAACCAAGTTGG - Intergenic
1082614147 11:55338069-55338091 CAGGGAGAACAGAAACAAGTTGG - Intergenic
1082867161 11:57910713-57910735 CAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1082876400 11:57992971-57992993 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1083510140 11:63201990-63202012 GAGGGTGAGCAGAAGCAGGTTGG + Intronic
1085260220 11:75200312-75200334 CAGGCTGACCAGGAGCAGGAAGG - Exonic
1085683634 11:78602042-78602064 CGGGGAGAACAGAACCAAGTTGG - Intergenic
1086414622 11:86576436-86576458 AAGGGTGAATAGAAGCAGAATGG - Intronic
1086421830 11:86644906-86644928 GAGGGTGAACAGAAGCAGGGTGG + Intronic
1088078379 11:105879186-105879208 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1088397344 11:109383016-109383038 CAGGCAGAAAAGAACCAGGACGG - Intergenic
1089101791 11:115968468-115968490 CAGGGTGAATGGAACCAAGTTGG + Intergenic
1089195971 11:116694269-116694291 CAGGCAGAACAGAGCCAAGAAGG + Intergenic
1090049347 11:123363624-123363646 CAAGGAGAACTGAACCATGAGGG - Intergenic
1090075873 11:123579722-123579744 TAGGGTGTACAGAATCTGGATGG - Intronic
1090216347 11:124968628-124968650 GAGGGTGAACCGAAGCAGGGTGG - Intronic
1090811620 11:130249640-130249662 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1090898724 11:131005766-131005788 CAGTGTGAACAGAATCACGTAGG + Intergenic
1091308387 11:134555556-134555578 CAGGGTGAATGGAACCACCAGGG + Intergenic
1092167606 12:6352597-6352619 CAGGGTATACAGAACTGGGATGG - Intronic
1092398876 12:8154208-8154230 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1092440320 12:8495749-8495771 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1092637479 12:10467195-10467217 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1093717641 12:22401624-22401646 CAGGGAGAATAGAACCAAGTTGG + Intronic
1094291321 12:28853348-28853370 CAGGATGAACAAAAACATGAAGG - Intergenic
1094694826 12:32808121-32808143 CAGGGAGAACAGAACCAAGTTGG - Intronic
1095528586 12:43157845-43157867 CAGGCTGTACAGAACCATGATGG + Intergenic
1095547449 12:43388326-43388348 GAGGGTGAACAGAAGCAGGCAGG - Intronic
1095920699 12:47526870-47526892 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1096021600 12:48329843-48329865 CAGGGCGAGGAGGACCAGGAGGG + Exonic
1096872770 12:54604540-54604562 CAGGGGGAAAAAGACCAGGAGGG + Intergenic
1099071449 12:78049504-78049526 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1099253801 12:80290186-80290208 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
1100136436 12:91558330-91558352 CAGGGAGAATAGAACCAAGTTGG + Intergenic
1100907651 12:99320290-99320312 CGGGGAGAACAGAACCAAGTTGG - Intronic
1102168165 12:110822421-110822443 CAAGGAGAACAGCCCCAGGAGGG + Intergenic
1102244814 12:111348535-111348557 CAGGGTGAAGAGGAGCAGGGGGG - Exonic
1102571487 12:113829627-113829649 CAGGGTGGACAGGACGAGGTGGG + Intronic
1103169238 12:118799447-118799469 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1104900047 12:132184737-132184759 CAGGGTGGAGAGAAGCAGGCTGG - Intergenic
1104941955 12:132399406-132399428 CAGGGTGTGAAGCACCAGGAAGG - Intergenic
1105475395 13:20724266-20724288 CTGGGTGACTAGAACCAGGCAGG - Intergenic
1105509268 13:21037805-21037827 CAGGGTGGTCAGGACCAGGGCGG + Intronic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1106429339 13:29665429-29665451 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1106537741 13:30662706-30662728 CAGTGTGAACTGAAAGAGGAAGG + Intergenic
1106582842 13:31032542-31032564 GATGGAGAAGAGAACCAGGATGG - Intergenic
1106874309 13:34055080-34055102 GAGGGTGAGCAGAAGCAGAATGG - Intergenic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1108940488 13:55947500-55947522 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1108940719 13:55949185-55949207 CAGGGAGAACAGAACCAAGTTGG + Intergenic
1109457570 13:62612017-62612039 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1110656648 13:78007886-78007908 AAGGGTGATCAGAAATAGGATGG - Intergenic
1110824598 13:79957955-79957977 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1110996030 13:82111042-82111064 CAGGGAGAATAGAACCAAGCTGG + Intergenic
1112166011 13:96920266-96920288 CAGGGAGAACTGAACCACGTTGG + Intergenic
1112305248 13:98267654-98267676 CAAGGTCAACAGAAACACGACGG + Intronic
1112620232 13:101047220-101047242 GAGGGGGAACAGAAGCAGGGTGG - Intergenic
1113089476 13:106602290-106602312 CACAGGGAACAGAAACAGGAGGG - Intergenic
1113960462 13:114123021-114123043 CAGGGTGTAGGGACCCAGGAAGG - Intronic
1114073090 14:19131441-19131463 CAGGGTGGACTGACCCGGGATGG + Intergenic
1114089176 14:19268542-19268564 CAGGGTGGACTGACCCGGGATGG - Intergenic
1114198715 14:20503580-20503602 CTGGGTGAATAAAACCAGGAGGG - Intergenic
1114360687 14:21968841-21968863 CAGGAAGAACAGAACCAAGTTGG + Intergenic
1114517091 14:23307157-23307179 GGGGGAGATCAGAACCAGGAGGG - Exonic
1114695561 14:24624010-24624032 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1114777629 14:25502795-25502817 GAGAGTGAATAAAACCAGGAGGG + Intergenic
1114844817 14:26308758-26308780 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1115355501 14:32442516-32442538 AGGGGTGAACTGAACCAGGCTGG + Intronic
1115357083 14:32460429-32460451 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1116227469 14:42170667-42170689 CAGGGAGAACGGAACCAAGTTGG - Intergenic
1116272848 14:42794770-42794792 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116565323 14:46438329-46438351 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116671441 14:47847332-47847354 CAGGGAGAACAGAACCAAGTTGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117120976 14:52568149-52568171 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1117280468 14:54235406-54235428 CAGGGAGAAAAGAACCAAGTTGG + Intergenic
1117632219 14:57705725-57705747 CAGGGTTAATAGGACCAGTAAGG - Intronic
1117850145 14:59958904-59958926 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1118116287 14:62780876-62780898 CAGGGGGAATATATCCAGGAGGG + Intronic
1118544869 14:66874801-66874823 CAGGGAGAACAGAACCAAGTTGG + Intronic
1119541999 14:75445326-75445348 CAGGTTGTACACAACCTGGAAGG - Intronic
1119767686 14:77200628-77200650 CAGGGGCAGCAGAGCCAGGATGG - Intronic
1121144439 14:91572080-91572102 CACATTGAACAAAACCAGGAGGG + Intergenic
1123203527 14:106691417-106691439 CAGGGGGCACAGAATCACGAGGG - Intergenic
1124474759 15:30023180-30023202 GAGGGTGAGCAGAATCAGGGTGG - Intergenic
1125219478 15:37317223-37317245 AAGGGTGAACTGAAGCAGGGTGG + Intergenic
1125609123 15:40958938-40958960 CAGGGTGAGGAGAGCCAGGGTGG + Intergenic
1128857595 15:71032273-71032295 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1129673495 15:77620108-77620130 CAGAATGAACAGTGCCAGGATGG - Intronic
1130058378 15:80550227-80550249 GAGGGTGAATGGAACAAGGATGG + Intronic
1130330523 15:82918656-82918678 CAGGGAGAACAGCAGCAGGGAGG - Intronic
1131609883 15:93949305-93949327 GGGGGTGAACATCACCAGGATGG + Intergenic
1132287809 15:100678162-100678184 CAGGGAGAACAGAACCAAGTTGG - Intergenic
1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG + Intronic
1132659272 16:1054298-1054320 GAGGGTGGGCAGCACCAGGAGGG - Intergenic
1132830728 16:1926766-1926788 GAGGGTGGCCAGAACCAGGTGGG - Intergenic
1134236267 16:12468661-12468683 CATGGAGAACAAAACCAGGCAGG - Intronic
1137629446 16:49931958-49931980 CAGGGTGAAAATGACCAGCATGG + Intergenic
1138151468 16:54661507-54661529 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1138396634 16:56709603-56709625 CTGGGTGATCTGCACCAGGATGG - Intronic
1138482650 16:57314048-57314070 CAGGGTGAACTGAGCCACCAGGG - Intergenic
1138652804 16:58471404-58471426 CAGAGTGATCAGAACGAGGCTGG - Intronic
1138886830 16:61090613-61090635 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1140603892 16:76510898-76510920 CAAGGTGAAAAAAACCAGTATGG - Intronic
1140653578 16:77115900-77115922 CAGGCTGTACAGAATTAGGAAGG - Intergenic
1141497515 16:84420165-84420187 CAGGGTGTACAGAGCAGGGAGGG - Intronic
1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG + Intergenic
1143427225 17:6849497-6849519 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1144087309 17:11822403-11822425 AAGGGTGGGGAGAACCAGGAAGG - Intronic
1144764439 17:17725022-17725044 CAGGGTCAGCAGCCCCAGGAGGG - Intronic
1146947954 17:36886528-36886550 CTGGGGGAAGAGAACAAGGAAGG + Intergenic
1147578692 17:41616873-41616895 CAGAGGGAACAGAGCCAGGCAGG - Intergenic
1147794058 17:43030218-43030240 CAGTGGGACCAGAGCCAGGAAGG - Intergenic
1149281358 17:55108703-55108725 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1149365373 17:55938837-55938859 GAGGGTGAGCAGAAGCAGGTTGG + Intergenic
1149509970 17:57232297-57232319 CAGGGTGAGGAGAGGCAGGATGG + Intergenic
1149513638 17:57263278-57263300 AAGGGAGAAGAGAACAAGGAGGG - Intronic
1149562420 17:57618272-57618294 GAGGGTGAACAGGACCAAGTTGG + Intronic
1150635265 17:66908662-66908684 GACGGTGACCAGGACCAGGATGG + Intergenic
1152489416 17:80619736-80619758 GAGGGTTAACACACCCAGGAGGG - Intronic
1153119114 18:1700113-1700135 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1156721396 18:40074363-40074385 AAGTGTGAAAAGAACCAAGATGG + Intergenic
1159011862 18:63065607-63065629 CAGGAAGCACAGAGCCAGGAAGG - Intergenic
1160751815 19:737951-737973 CAGGGAGAACAGACCGTGGACGG + Intronic
1161167360 19:2795446-2795468 GAGGATGAACAGCAGCAGGAGGG - Intronic
1161945755 19:7435501-7435523 CAGGGTGAGCAGGTTCAGGATGG + Intronic
1163207564 19:15814804-15814826 CAGGGTGTAAAGAATCAGGGTGG - Intergenic
1163386287 19:17002118-17002140 CAGGGAGGAGGGAACCAGGAAGG + Intronic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1164436289 19:28232721-28232743 CAGGGTCCTCAGATCCAGGAAGG + Intergenic
1164794605 19:31015649-31015671 CAGGGCCAACAGGACCAGAAAGG + Intergenic
1164841783 19:31398201-31398223 CAGGCTGTACAGAACCTGCATGG - Intergenic
1164935633 19:32208230-32208252 CAGGGGGAAGGGAATCAGGAGGG + Intergenic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165600591 19:37052960-37052982 CAGGGAGAATAGAACCAAGCTGG - Intronic
1166103021 19:40582509-40582531 CAGACTGTACAGACCCAGGAAGG + Intronic
1167508025 19:49881364-49881386 CTGGGTCACCAGAACCAGGTAGG - Exonic
1167594330 19:50419127-50419149 AAGAGGGAACAGAACCAGAAGGG - Intronic
1167595130 19:50423503-50423525 GAGGGAGACCAGAGCCAGGAGGG + Intronic
1167674527 19:50876114-50876136 GAGAAAGAACAGAACCAGGAAGG - Intronic
925132452 2:1503469-1503491 CAGGGGGAGCAGGAGCAGGAGGG + Intronic
925442167 2:3898045-3898067 CAGGGAGAACAGAACCAAGTTGG - Intergenic
926044982 2:9703726-9703748 CAGGGTGAGCAGAGCCAAGTGGG - Intergenic
926607643 2:14913691-14913713 CAGGGGAAACAGAACCAGCTTGG + Intergenic
926905985 2:17806072-17806094 CAGGGTGCACAGAGCCAGCAGGG + Intergenic
927007118 2:18862185-18862207 CATGTAGAACAGAAACAGGAAGG + Intergenic
927021165 2:19019153-19019175 CAGGGAGAATGGAACCAGGTTGG - Intergenic
927180787 2:20445571-20445593 CAGCCTGAACACAAGCAGGAAGG - Intergenic
927182715 2:20458450-20458472 GAGGGTGAGCAGAAGCAAGATGG + Intergenic
927293955 2:21431990-21432012 CAGGGAGAACAGAAGCAGTAAGG + Intergenic
927436857 2:23073955-23073977 CAGGTTGAACAGAGCAAGGATGG - Intergenic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
928488203 2:31754194-31754216 GAGGGTGAGCAGAAACAGGGTGG + Intergenic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929958208 2:46476639-46476661 CAGGGAGAATGGAACCAGGTTGG - Intronic
930455581 2:51604477-51604499 CAGGGAGAACAAAACCAAGTTGG - Intergenic
930951248 2:57146391-57146413 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
932374603 2:71224680-71224702 CAGGGTGCAGAGAAGCACGATGG - Intronic
932585052 2:73022485-73022507 CAGGCTGACCAGAACCAGAAGGG + Intronic
932627968 2:73314039-73314061 CAGGATGAACAGGGCTAGGAAGG + Intergenic
932779848 2:74553375-74553397 CAGGGTCAAGAGGCCCAGGAGGG + Intronic
936900037 2:117472340-117472362 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
937216425 2:120316361-120316383 CAGGGTGGCCAGAGCCAGGGAGG + Intergenic
937977012 2:127588571-127588593 CAGGGGTGACAGACCCAGGAGGG - Intronic
938144658 2:128823534-128823556 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
938167996 2:129049285-129049307 CAGGGAGAATGGAACCAGGTTGG - Intergenic
938224357 2:129602877-129602899 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
938445573 2:131374819-131374841 CGGGGAGAACAGAACCAAGTTGG + Intergenic
938708281 2:133953026-133953048 AAGGGAGAACAGAAACAGGAAGG + Intergenic
938874263 2:135516870-135516892 CAGGGAGAATAGAACCAAGTTGG - Intronic
939180306 2:138795794-138795816 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
939346286 2:140970121-140970143 CAGGGAGAATGGAACCAGGTTGG - Intronic
940352806 2:152707638-152707660 CAGTCTGAGCAGAGCCAGGAAGG - Intronic
940995800 2:160148620-160148642 GAGGGTGAGCAGAAGCAGGGCGG + Intronic
941518799 2:166511843-166511865 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
941682420 2:168413339-168413361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942407376 2:175669859-175669881 CAGGGAGAATGGAACCAAGATGG + Intergenic
942431380 2:175914596-175914618 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942842077 2:180374183-180374205 CAGGTTGTACAGGACCATGATGG - Intergenic
944035661 2:195291560-195291582 CAGGGAGAACGGAACCAAGTTGG + Intergenic
944087270 2:195863801-195863823 CAGGGTTAAGGGAACCAAGAGGG - Intronic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
944267820 2:197748093-197748115 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
944374899 2:199030008-199030030 CAGGGAGAACGGAACCAAGTTGG + Intergenic
945210968 2:207381467-207381489 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946523985 2:220497801-220497823 CAGGATTGAAAGAACCAGGAAGG + Intergenic
946912904 2:224484978-224485000 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
947098433 2:226592486-226592508 GAGGGTGAAGAGAAGCAGGGTGG - Intergenic
947364595 2:229381118-229381140 GAGGGCGAGCAGAAGCAGGATGG + Intronic
947536473 2:230942961-230942983 CTAGGGGAACAGAAGCAGGATGG - Intronic
948457597 2:238114063-238114085 CAGGGAGGAGAGAACCAGGTGGG - Intronic
948564966 2:238879127-238879149 CAGAGGGGACAGAGCCAGGAAGG - Intronic
948600942 2:239107180-239107202 CAGGGTGAAGAGCACCAGCTGGG + Intronic
1169111771 20:3038740-3038762 CAGAGAGAACAGCAACAGGAGGG - Intronic
1169192751 20:3668448-3668470 CAGGGTGGGAAGAAACAGGAAGG + Exonic
1169204180 20:3730859-3730881 GAGGCTGAGCAGAGCCAGGAGGG - Intergenic
1169564042 20:6833354-6833376 CAGAGTAAAAAGAACCATGAAGG + Intergenic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170685553 20:18566635-18566657 CAAGGTGAAAAGAACCCTGAAGG + Intergenic
1172384898 20:34527210-34527232 CAGGCTGTAAAGAACCAGAATGG + Intronic
1173662835 20:44745936-44745958 CAGGGTGCACAGGACCAGCCCGG - Exonic
1173720616 20:45254499-45254521 CAGGGCAAGCAGCACCAGGAAGG + Exonic
1174192511 20:48750281-48750303 GAGGGTGAAGGGGACCAGGAGGG - Intronic
1175019024 20:55824861-55824883 CAGGGTGAAGAGGCCAAGGATGG + Intergenic
1175913964 20:62417104-62417126 CAGGATAAACTGAACCAGGAAGG - Intronic
1176069186 20:63217195-63217217 CAGGGTGAACAGTGACAGCAGGG + Intergenic
1178864534 21:36316971-36316993 GAGGGTGAACAGAAGCAGGGTGG - Intergenic
1179293671 21:40042076-40042098 CAGGGAGAACACAGCCAGGTCGG + Intronic
1180036881 21:45254688-45254710 AAGGGTGAACAGAGGCAGGCAGG + Intergenic
1180073534 21:45450403-45450425 TAGGGTGGCCAGAAGCAGGAGGG + Intronic
1180491531 22:15853794-15853816 CAGGGTGGACTGACCCGGGATGG + Intergenic
1180540968 22:16447367-16447389 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
1180575290 22:16767500-16767522 CAGGGAGAACAGAACCAAGTTGG + Intergenic
1180847492 22:18991906-18991928 CAGGGTGAACTCCACCAGGACGG - Intergenic
1181265346 22:21627962-21627984 CAGCATGAACAAAACCAGAATGG + Intergenic
1181441709 22:22939378-22939400 CAGGGAGAACACCACCAGGATGG + Intergenic
1181809652 22:25395629-25395651 CAAGGTGGACAGAGCCTGGAGGG + Intronic
1182173410 22:28256623-28256645 CAGGGTAAAAAGAACAAGGCTGG + Intronic
1183980765 22:41538692-41538714 CAGTGTGAAAACAACCACGAGGG - Intronic
1184046038 22:41972722-41972744 CAGAGTGAACAGAGCCAAGCTGG + Intergenic
1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG + Intronic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184549996 22:45199424-45199446 GAGGCTGCACAGAGCCAGGAGGG + Intronic
1184732927 22:46380844-46380866 CAGGGCGAACTCCACCAGGACGG + Exonic
1184838098 22:47035880-47035902 CAGGGGGAAGAGGAACAGGAGGG - Intronic
949226886 3:1705531-1705553 GAGGGTGAACTGAAGCAGGGTGG + Intergenic
949456671 3:4246232-4246254 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
949632613 3:5944545-5944567 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
950991945 3:17449082-17449104 GAGGGTGAGCAGAAGCAGCATGG + Intronic
951360964 3:21723693-21723715 CAGGGAGAATAGAACCAAGTTGG + Intronic
951448880 3:22814081-22814103 CAGTGGCAACAGAAACAGGATGG - Intergenic
951617705 3:24566884-24566906 GAGGGTGAACTGAAGCAGGCGGG + Intergenic
951741600 3:25931326-25931348 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951789609 3:26465552-26465574 CAGGGAGAATAGAACCAAGTTGG + Intergenic
951826584 3:26875657-26875679 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951832085 3:26942470-26942492 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
952202421 3:31144828-31144850 CAGGGAAAACAGAACTAAGAGGG - Intergenic
952572438 3:34733053-34733075 CAGGGAGAACGGAACCAAGTTGG + Intergenic
952574285 3:34755919-34755941 AAGGGCAAAAAGAACCAGGAAGG - Intergenic
952960208 3:38584297-38584319 CAGAGTGATCAGAACCATTAAGG - Intronic
953053080 3:39363406-39363428 CAGGGAGAACAGAACCAAGTTGG + Intergenic
953555867 3:43946353-43946375 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
954586591 3:51741917-51741939 GAGGGTCAAAAGACCCAGGAGGG - Intergenic
956207516 3:66770105-66770127 CAGGGAGAATAGAACCAAGTGGG - Intergenic
956301989 3:67781911-67781933 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
956397969 3:68846112-68846134 CAGGGTGAATGGAACCAAGCTGG - Intronic
956642857 3:71431034-71431056 CATGGTGGACAGAACCAGGCAGG + Intronic
956776866 3:72572401-72572423 CAGGGAGACCAGAGCCAGGAGGG - Intergenic
957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
959453689 3:106533909-106533931 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
959489016 3:106964875-106964897 CAGTGTGAAAAAAATCAGGATGG - Intergenic
959765058 3:110016479-110016501 CAAGGTGAACAGAACAAAGAAGG - Intergenic
959883378 3:111472492-111472514 CAGGGAGAACAGAACCAAGATGG - Intronic
960455255 3:117863366-117863388 CAGAGTGAACATAACCTTGAAGG + Intergenic
960502863 3:118458260-118458282 CAGGGAGAACGGAACCAAGTTGG + Intergenic
960773236 3:121217477-121217499 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
962156763 3:132956549-132956571 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
962196037 3:133364597-133364619 TAGAGTGACCAGAACCTGGAAGG + Intronic
962706393 3:138048881-138048903 CACTGTGAACAGAACATGGAAGG - Intergenic
963027604 3:140934902-140934924 CAGGGAGAATGGAACCAAGATGG + Intergenic
963410933 3:144926793-144926815 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
963998639 3:151740288-151740310 GAGGGCGAACAGAAGCAGGGTGG - Intronic
964391325 3:156201110-156201132 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
964904752 3:161706934-161706956 GAGGGTGGACAGAAGCAGGGTGG + Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
968809712 4:2794354-2794376 CAGAGTGGGAAGAACCAGGAGGG - Intronic
969693869 4:8724105-8724127 CAGGCTGAAAAGAACCATGGGGG + Intergenic
969714819 4:8863382-8863404 CTGGGTGAGCAGCACCAGGGAGG - Intronic
969952464 4:10852710-10852732 CAGGGAGAATGGAACCAAGATGG - Intergenic
970214605 4:13745665-13745687 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
971285874 4:25289692-25289714 CAGGGAGAAGAGAACCAAGTTGG - Intergenic
971883401 4:32410883-32410905 CAGGGAGAATAGAACCAAGCTGG + Intergenic
972255723 4:37353441-37353463 CAGGGAGAATAGAACCAAGTTGG - Intronic
972260945 4:37407878-37407900 GAGGGCGAGCAGAAGCAGGATGG + Intronic
972972507 4:44594614-44594636 CAGGGAGAATAGAACCAAGTTGG + Intergenic
973544966 4:51972323-51972345 CAGGGAGAACAGAACCAAGTTGG - Intergenic
973558209 4:52107573-52107595 CAGGGTGAATGGAACCAGCTGGG + Intergenic
974899578 4:67980939-67980961 CAGGGAGAACAGAACCAAGTGGG - Intergenic
975246032 4:72121294-72121316 CAGGGAGAATAGAACCAAGTGGG + Intronic
975352547 4:73361649-73361671 CAGGGAGAATAGAACCAAGTTGG + Intergenic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975524168 4:75331146-75331168 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
975638700 4:76477821-76477843 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
975744498 4:77463189-77463211 CAGGGAGAATGGAACCAAGATGG - Intergenic
975806383 4:78117430-78117452 CAGGGAGAACGGAACCAAGTTGG - Intronic
976203480 4:82602129-82602151 AAGGGGGAACAAATCCAGGATGG - Intergenic
977185723 4:93933055-93933077 AAGGGTGAGCAGAATCAGGGTGG - Intergenic
977630069 4:99232577-99232599 CAGGGAGAATAGAACCAAGTTGG - Intergenic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
978328052 4:107580727-107580749 CAGGGAGAAGAGAACCAAGTTGG + Intergenic
979344865 4:119575229-119575251 CAGGGAGAATAGAACCAAGTTGG + Intronic
979628389 4:122872418-122872440 CAGGGAGAACAGAAACAAGCTGG + Intronic
980512647 4:133813637-133813659 CAGGGAGAACGGAACCAAGTTGG + Intergenic
980875640 4:138659410-138659432 GAGGGAGAAGAGAAGCAGGAGGG + Intergenic
980991824 4:139744846-139744868 CAGGCTGACCAGACCCGGGATGG + Intronic
981273991 4:142876153-142876175 CAGGGAGAACAGAACCAAGTTGG + Intergenic
981374451 4:143997483-143997505 CAGTGTGAACAGCTCTAGGAGGG - Intronic
981395938 4:144249082-144249104 CAGGGAGAATGGAACCAAGATGG - Intergenic
982815468 4:159878220-159878242 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
982915498 4:161203793-161203815 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
983840777 4:172455059-172455081 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
984224390 4:177017357-177017379 GAGGGTGAACCGAAGCAGGGCGG + Intergenic
984278644 4:177640208-177640230 CAGGGTAAGCAGAGCCAGAAAGG - Intergenic
986010188 5:3706999-3707021 TAGGGAGAAAAGAACCAGGAGGG - Intergenic
986241426 5:5963417-5963439 GAGGGTGAACTGAAGCAGGCAGG + Intergenic
986484500 5:8221558-8221580 CAGGGAGAATAGAACCAAGTTGG + Intergenic
988618130 5:32794853-32794875 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
988728537 5:33947241-33947263 CAGGCTGCACAGGACCAGGGTGG + Exonic
989358114 5:40567359-40567381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
989451878 5:41596466-41596488 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
989825260 5:45847646-45847668 GAGGGAGAACAGAAGCAGGGTGG + Intergenic
990098779 5:52156486-52156508 GAGGGTGAGCAGAAACAGGGTGG + Intergenic
990231286 5:53715853-53715875 GAGAGTGAACAGAAGCAAGATGG + Intergenic
990332919 5:54745214-54745236 GAGGGCAAACAGAACCAGTAGGG + Intergenic
991654587 5:68891575-68891597 CAAGGTCAAGAGAACCAGAATGG + Intergenic
992077767 5:73206913-73206935 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992287207 5:75247990-75248012 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992740702 5:79770583-79770605 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
993402846 5:87474119-87474141 CAGGGAGAATGGAACCAAGATGG + Intergenic
993432030 5:87843421-87843443 CAGGGGGAATAAAACAAGGAAGG - Intergenic
993609166 5:90033058-90033080 CAGGGAGAACGGAACCAAGTTGG + Intergenic
994014963 5:94955109-94955131 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
994298141 5:98114979-98115001 CAGGGAGAACGGAACCAAGTTGG + Intergenic
994298954 5:98122927-98122949 CAGGGAGAATAGAACCAAGTTGG + Intergenic
994744266 5:103659232-103659254 CAGGGAGAGCAGCAACAGGAAGG + Intergenic
995263860 5:110136247-110136269 GAGGGTGAGCAGAAGCAGGCTGG - Intergenic
995340808 5:111057047-111057069 CAGGGAGAATAGAACCAAGTTGG - Intergenic
995464339 5:112435843-112435865 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
995474955 5:112538796-112538818 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
995790742 5:115883499-115883521 AAGGGTGAGCAGAAGCAGGGTGG - Intronic
996428000 5:123335642-123335664 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
996592189 5:125160540-125160562 GAGAGTGAACAGAAGCAGGGTGG + Intergenic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
997809608 5:136954339-136954361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
998691905 5:144596290-144596312 GAGGGTGAACCGAAGCAGGGTGG - Intergenic
999787878 5:154908546-154908568 CAGGCTGAAGGGAACCAGAAAGG - Intronic
1000194858 5:158947487-158947509 GAGGGCGAGCAGAAGCAGGACGG - Intronic
1000574791 5:162964661-162964683 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1001543163 5:172553286-172553308 GAGGCTGGAAAGAACCAGGAAGG + Intergenic
1001976850 5:176007178-176007200 CAGGGTGACCAGAGACAGGTGGG - Intronic
1002240578 5:177836602-177836624 CAGGGTGACCAGAGACAGGTGGG + Intergenic
1003505075 6:6734072-6734094 GAGGGTGAAGAGAACAGGGAGGG - Intergenic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1007937029 6:45741584-45741606 CAGAGTGGGCAGAAACAGGAGGG - Intergenic
1008719305 6:54329017-54329039 CAGGGCGAATAGAACCAAGTTGG + Intronic
1008893289 6:56521375-56521397 CAGGCTGAACACAAACAAGAGGG - Intronic
1009570095 6:65374233-65374255 AAGGGTGAGCAGAAGCAGGGTGG + Intronic
1009718335 6:67428676-67428698 GAGGGCGAACAGAAGCAGGATGG - Intergenic
1010574870 6:77518357-77518379 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1010973191 6:82284485-82284507 GAGGGTGAGCCGAACCAGGGTGG - Intergenic
1011235656 6:85213452-85213474 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011299009 6:85854198-85854220 GAGGGTGAGCAGAAACAGGGTGG - Intergenic
1011387776 6:86815927-86815949 GAGGGTGAGCCGAACCAGGGTGG - Intergenic
1011578370 6:88828931-88828953 CAGGGAGAATGGAACCAAGATGG + Intronic
1011831315 6:91374987-91375009 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1012554870 6:100499124-100499146 CAGGGAGAATAGAACCAAGTTGG + Intergenic
1012778169 6:103523438-103523460 CAGGGAGAACGGAACCAAGTTGG + Intergenic
1013024956 6:106262703-106262725 GAGGGTGACCAGAAGCAGGGTGG + Intronic
1013682506 6:112541095-112541117 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1013920239 6:115394892-115394914 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1014527905 6:122522706-122522728 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1015009005 6:128320827-128320849 CAGGGTCCACAGCCCCAGGAGGG - Intronic
1016168076 6:140972908-140972930 AAGGGAGAACAGAACCAAGTTGG - Intergenic
1017322796 6:153112466-153112488 CAGGGAGAATAGAACCAAGTTGG + Intronic
1017357039 6:153521464-153521486 GAGGGTGAGCTGAAGCAGGAGGG - Intergenic
1018276664 6:162139511-162139533 CAGGGTAAAGAGAATCAGCATGG + Intronic
1019073938 6:169371608-169371630 CAGAGCGAGCAGCACCAGGAAGG + Intergenic
1019203753 6:170341775-170341797 GAGGGTGACCAGAAGCAGGGTGG - Intronic
1019319452 7:409024-409046 CTGGGTGGACAGACCCTGGAAGG - Intergenic
1020391241 7:7660899-7660921 CAGGGAGAATAGAACCAAGTTGG - Intronic
1020391501 7:7662610-7662632 GAGGGCGAACAGAAACAGGGTGG - Intronic
1020665921 7:11043928-11043950 CAGGCTGAGCAGTATCAGGAGGG - Intronic
1020823930 7:13003261-13003283 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021301777 7:18982007-18982029 CAGGGAGAAGAGAATCAGGGTGG + Intronic
1021347751 7:19548540-19548562 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021595700 7:22314233-22314255 CTGGCTGAAGAGAAGCAGGAAGG + Intronic
1022058930 7:26770750-26770772 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1022072573 7:26931644-26931666 CAGGGAGAATGGAACCAAGATGG + Intronic
1023051841 7:36259139-36259161 GAGGGCGAGCTGAACCAGGATGG - Intronic
1023096874 7:36670384-36670406 CATGGTGGACAGAACCACGAAGG + Intronic
1023357353 7:39380763-39380785 CACTGTGAAGAGAACCAAGAAGG - Intronic
1023511707 7:40959969-40959991 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1023570030 7:41562249-41562271 AAGGGTGACCAAAATCAGGAGGG + Intergenic
1023622379 7:42086758-42086780 CAGGTTGGCCAGAACCAGTAGGG + Intronic
1023894230 7:44418771-44418793 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1024835257 7:53510839-53510861 CAGGAAGAGCAGGACCAGGAAGG + Intergenic
1024950590 7:54856321-54856343 GAGGGTGAACAGAAGCAGTGTGG - Intergenic
1024998604 7:55295208-55295230 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
1025300378 7:57815182-57815204 CAGGCTGAACACAACGTGGAAGG + Intergenic
1027447343 7:78289494-78289516 CAGGGAGAATAGAACCAAGTTGG + Intronic
1028027810 7:85867982-85868004 CAGGGAGAACAGAACCAAGTTGG + Intergenic
1028523158 7:91753987-91754009 CAGGGAAAACAAAACCAAGATGG + Intronic
1029017714 7:97331273-97331295 CAGGGAGAATGGAACCAAGATGG + Intergenic
1030426196 7:109382049-109382071 CAGGGAGAATAGAACCAAGTTGG + Intergenic
1030482225 7:110119552-110119574 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1030771178 7:113476204-113476226 TAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1031323436 7:120362871-120362893 CAGGGTGAACAGAACCAGGAAGG + Intronic
1031986231 7:128166457-128166479 CAGGGTGAAATGAACCAACAGGG + Intergenic
1032659834 7:133970640-133970662 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1032893225 7:136222315-136222337 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1033582102 7:142747629-142747651 CAGGAAGAAAAGCACCAGGAAGG + Intergenic
1033583628 7:142758428-142758450 CAGGAAGAAAAGCACCAGGAAGG + Intronic
1033585112 7:142769003-142769025 CAGGAAGAAAAGCACCAGGAAGG + Intergenic
1033871287 7:145756747-145756769 CAGAGTTAACATAACCAGTAAGG - Intergenic
1034314402 7:150116928-150116950 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1034792493 7:153983841-153983863 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1035053396 7:156017666-156017688 CAGGATGCACAGAGCCAGGTGGG + Intergenic
1035636973 8:1155007-1155029 GAGTGGGAACAGAAGCAGGATGG - Intergenic
1035639353 8:1172482-1172504 CAGGGAGAACAGAACCAAGTTGG - Intergenic
1035793982 8:2336757-2336779 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1035798823 8:2384951-2384973 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1036745580 8:11406656-11406678 CAGGGAGAATAGAACCAAGTTGG - Intronic
1037285559 8:17294725-17294747 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1037421811 8:18710388-18710410 CAGGGGGAACAGAACCAGGTTGG + Intronic
1038319799 8:26515263-26515285 CAGCGTGAGAAGAGCCAGGAAGG + Intronic
1039282892 8:36006258-36006280 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
1039893095 8:41697571-41697593 CAGTTAGCACAGAACCAGGAGGG - Intronic
1040070955 8:43188241-43188263 CGGGGAGAACAGAACCAAGTCGG - Intronic
1040431600 8:47348553-47348575 CAGGGAGAATGGAACCAAGATGG - Intronic
1040968890 8:53112787-53112809 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1041419160 8:57647278-57647300 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1041904142 8:63013196-63013218 AAGAATGAACAGAAACAGGAAGG - Intergenic
1042410618 8:68461334-68461356 CAGGGAGAATGGAACCAGGTTGG + Intronic
1043036749 8:75208635-75208657 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1043253749 8:78106872-78106894 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044203090 8:89459059-89459081 CAGGGGGAATAGAACCAAGTTGG + Intergenic
1044225140 8:89709716-89709738 CAGGGTGAATGGAACCAAGTTGG + Intergenic
1044509559 8:93058759-93058781 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044940346 8:97335434-97335456 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044968181 8:97594173-97594195 CAGGGAGAATAGAACCAAGTTGG - Intergenic
1045185265 8:99830895-99830917 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1045390499 8:101710120-101710142 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1045509727 8:102805502-102805524 CTGGGTGAACAGAACCGGTCTGG - Intergenic
1045797850 8:106066617-106066639 CAGGGAGAAGAGAACCAAGTTGG + Intergenic
1046007554 8:108504895-108504917 CGGGGAGAACAGAACCAAGTTGG - Intergenic
1046014550 8:108589901-108589923 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1046220108 8:111202464-111202486 CAGGGAGAACAGAACCAAGTTGG + Intergenic
1046295781 8:112217972-112217994 GAGGGTGAACAGAACCAGGGTGG + Intergenic
1046879629 8:119293566-119293588 CAGGGAGAATAGAACCAAGTTGG + Intergenic
1047175074 8:122532852-122532874 CAGGGTGGTGAGAACAAGGAGGG + Intergenic
1047548579 8:125844203-125844225 CAGGGTGAGCAAAAAAAGGATGG - Intergenic
1047628953 8:126684812-126684834 GTGGGAGAACAGAAACAGGATGG - Intergenic
1047762649 8:127965598-127965620 CAGAGTGGAGAGAACAAGGAAGG - Intergenic
1048292457 8:133191292-133191314 CAGGATGAAAAGGGCCAGGAAGG + Intronic
1048962884 8:139594866-139594888 CAGAGTTAAGGGAACCAGGAAGG + Intergenic
1049039836 8:140104264-140104286 CAGCCTGAACGGAACCAGGAGGG + Intronic
1049137697 8:140919060-140919082 CAGTGTGTGCAGCACCAGGAAGG + Intronic
1049743323 8:144251278-144251300 AAAGGTCAACAGTACCAGGAAGG - Intronic
1049880198 8:145056819-145056841 CAGGGTGAGGAGAAGCAGGGGGG - Intergenic
1050973990 9:11912724-11912746 CAGTGTGAGCAGAAGCAGGTGGG - Intergenic
1051160285 9:14199966-14199988 CAGGGAGAACAGGAGCAGAAGGG + Intronic
1051452057 9:17207635-17207657 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1051603665 9:18898563-18898585 CAGGGAGAACAGAACCAAGTTGG + Intronic
1052144127 9:25026158-25026180 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1052887692 9:33666172-33666194 GAGGGTGAGCTGAACCAGGGCGG + Intergenic
1053216106 9:36271971-36271993 CAGAGAGAAAAGAACAAGGATGG - Intronic
1055339053 9:75262234-75262256 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1055345124 9:75327443-75327465 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1055628676 9:78200799-78200821 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1055823970 9:80301562-80301584 GAGGGCGAGCAGAAGCAGGATGG - Intergenic
1056385227 9:86091052-86091074 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057882363 9:98802153-98802175 CAGGGTGAAGAGAAACAGCAGGG + Intergenic
1058265712 9:102897255-102897277 GAGGGTGAGCAGAAGCAGGGAGG + Intergenic
1058324162 9:103674672-103674694 CAAGGTTAACATAACCAGCAAGG - Intergenic
1058941343 9:109815524-109815546 CAGGGTAGACAGAAACAGGGGGG + Intronic
1060773409 9:126349103-126349125 CAGGGAGAAACGAGCCAGGAAGG + Intronic
1061764614 9:132873956-132873978 CAGAGTAAACTGCACCAGGAAGG + Intronic
1062582494 9:137234724-137234746 CAGGGTGGACAGTACCTGCAGGG - Exonic
1062671840 9:137715518-137715540 CAGGAAGAACAGAGCCAGGAAGG + Intronic
1186181400 X:6976496-6976518 GAGGGTGAGCAGAAACAGGGTGG - Intergenic
1186740846 X:12516790-12516812 CAGGGGGAACAGAACCAAGTTGG - Intronic
1186773393 X:12839656-12839678 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1187215305 X:17269967-17269989 CAGGCTGAAGACAACCAGCATGG + Intergenic
1187224964 X:17366977-17366999 CTGGGTGAAGAGAATCTGGAAGG + Intergenic
1187248408 X:17574671-17574693 GAGGGTGAGCCGAAGCAGGATGG - Intronic
1187289564 X:17940068-17940090 CAGTGAGAGCAGAAGCAGGAGGG - Intergenic
1187573784 X:20532582-20532604 CAGAGTTAACCTAACCAGGATGG - Intergenic
1187649559 X:21387390-21387412 GAGGATCACCAGAACCAGGAAGG + Intronic
1187660759 X:21544734-21544756 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1187790133 X:22941702-22941724 CTGGGTGACCAGACCCAGTAAGG + Intergenic
1188915539 X:35905161-35905183 GAGAGTGAGCAGAAGCAGGATGG - Intergenic
1189250562 X:39598161-39598183 ACAGGTGAAAAGAACCAGGAGGG + Intergenic
1189251794 X:39606073-39606095 CAGGGAGAACAGAACTTGGCTGG + Intergenic
1189590794 X:42508559-42508581 CAGGGAAAACAGAACCATGTTGG + Intergenic
1189595765 X:42563840-42563862 CTCGGTGAACAGGACCAGGAGGG + Intergenic
1189939942 X:46111392-46111414 CAGGGAGAACAGAACCAAGTTGG - Intergenic
1189978320 X:46484965-46484987 CGGGGAGAACAGAACCAAGTAGG - Intronic
1190420229 X:50222863-50222885 CAGGGAGAATGGAACCAAGATGG - Intronic
1190422599 X:50300732-50300754 CAGGGAGAATGGAACCAAGATGG - Intronic
1190963805 X:55278395-55278417 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191004996 X:55702268-55702290 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191087583 X:56586120-56586142 CAGGGAGAATGGAACCAAGATGG - Intergenic
1191148181 X:57190691-57190713 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1191153175 X:57242604-57242626 GAGGGTGAGCAGAAACAGGGTGG + Intergenic
1191174241 X:57482534-57482556 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191591253 X:62887957-62887979 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191660822 X:63647993-63648015 CAGGGAGAACGGAACCAAGTTGG + Intronic
1191676556 X:63797624-63797646 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191809374 X:65170632-65170654 CAGGGAGAATGGAACCAAGATGG - Intergenic
1191835093 X:65455520-65455542 CAGGGAGAATAGAACCAAGTTGG + Intronic
1191951509 X:66598406-66598428 CACGAGGAACAGAGCCAGGATGG + Intronic
1191987306 X:66995435-66995457 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192009176 X:67250062-67250084 GAAGGTGAACAGAAGCAGGGTGG + Intergenic
1192204688 X:69088222-69088244 CAGGGAAATCAGAACCAGGCTGG - Intergenic
1192759273 X:74078346-74078368 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192806338 X:74512798-74512820 GAGGGCCAACAGATCCAGGATGG + Intronic
1192953251 X:76039897-76039919 GAGGGTGAACAGAAGCAGTGTGG - Intergenic
1192958030 X:76094436-76094458 CAGGGAGAATAGAACCAAGTTGG - Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1192980292 X:76332183-76332205 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1193019981 X:76781082-76781104 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193398182 X:81010527-81010549 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193514314 X:82445443-82445465 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1193594939 X:83434597-83434619 CGGGGAGAACAGAACCAAGTTGG - Intergenic
1194203193 X:90979359-90979381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194242484 X:91469628-91469650 GAGGGCGAACAGAAGCAGGTGGG + Intergenic
1194315371 X:92369793-92369815 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1194420084 X:93662232-93662254 CAGGGAGAATAGAACCAAGTTGG + Intergenic
1194631539 X:96291548-96291570 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1194643487 X:96429882-96429904 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194930558 X:99882059-99882081 CAGGGAAAACAGAACCAAGCTGG + Intergenic
1195826331 X:109004889-109004911 CAGGGAGAATAGAACCAAGTTGG + Intergenic
1195832803 X:109078024-109078046 CAGGGTGAACCAAAGCAGGGTGG - Intergenic
1195916048 X:109936528-109936550 CAGTGTTAACAGATCCAGTAAGG - Intergenic
1196133315 X:112181025-112181047 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1196277194 X:113780425-113780447 TATGGTGAACCCAACCAGGATGG - Intergenic
1196367891 X:114943465-114943487 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1196600046 X:117591016-117591038 AAAGGTGAACAGAACCAAGTTGG + Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197505917 X:127305663-127305685 GAGGGCGAACAGAAGCAGGGTGG + Intergenic
1197606943 X:128596273-128596295 CAGGGAGAATGGAACCAGGTTGG - Intergenic
1197614400 X:128675351-128675373 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1197730368 X:129804695-129804717 TAGTGTGAACAGGATCAGGAAGG - Exonic
1197858408 X:130944015-130944037 CAGGGTGAAAAGAACAATAAAGG - Intergenic
1197880604 X:131163006-131163028 CAGGGTGAATGGAACCAAGTTGG - Intergenic
1197926853 X:131656071-131656093 TAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1198549982 X:137735186-137735208 CAGGGAGAACAGATGCATGAAGG - Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198687240 X:139239399-139239421 CAGGGAGAATAGAACCAGGTTGG + Intergenic
1198714313 X:139540143-139540165 AAGGATGAATAGAACCAGAAGGG - Intronic
1198725866 X:139676295-139676317 GAGGGTGAACTGAAGCAGGGTGG - Intronic
1198944624 X:141996603-141996625 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1199173220 X:144756229-144756251 CAGGGAGAACCGAACCAAGTTGG - Intergenic
1200247348 X:154533231-154533253 CAGGGTGAGCAGAGCCAAGCAGG - Intronic
1200365497 X:155657899-155657921 GAGGGTGAGCAGAACCAGGGTGG - Intronic
1200388337 X:155916954-155916976 CAGGGAGAACAGAACCAAGTTGG - Intronic
1200549026 Y:4554785-4554807 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1200623420 Y:5481328-5481350 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1201493238 Y:14565564-14565586 CAGGGAGAATAGAACCAAGCTGG + Intronic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201563660 Y:15344161-15344183 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1201688648 Y:16736701-16736723 CAGGGAGCACGGAACCAAGAGGG - Intergenic
1201922123 Y:19245213-19245235 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic