ID: 1031324542

View in Genome Browser
Species Human (GRCh38)
Location 7:120377322-120377344
Sequence GTGAAAAATACATCCAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 311}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031324541_1031324542 -9 Left 1031324541 7:120377308-120377330 CCTTCATTTACTGTGTGAAAAAT 0: 1
1: 0
2: 3
3: 31
4: 379
Right 1031324542 7:120377322-120377344 GTGAAAAATACATCCAGAGAAGG 0: 1
1: 0
2: 2
3: 41
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031324542 Original CRISPR GTGAAAAATACATCCAGAGA AGG Intronic
901845873 1:11981686-11981708 GGGAAAGGTACATCCAGAGAGGG - Intronic
902436583 1:16401932-16401954 GTGAAAGAGACATCCACACAGGG + Intronic
905690316 1:39937840-39937862 GGGAAAAGTAAACCCAGAGAAGG - Intergenic
906001398 1:42429396-42429418 CTGAAAATTAGATCAAGAGATGG + Intergenic
906451744 1:45955510-45955532 GAGAAAAATATATCAAGAAAGGG + Intronic
906549050 1:46646338-46646360 TTGAAACATCCATCAAGAGAAGG - Intronic
906587828 1:46995349-46995371 GTGAAATATCCATCCAGGAAAGG + Intergenic
906859478 1:49343413-49343435 GGGAAATATACATTCAGAAATGG + Intronic
907756917 1:57319502-57319524 AAGAAACAGACATCCAGAGAAGG - Intronic
908207952 1:61870273-61870295 GAGAATAATCCAGCCAGAGATGG - Intronic
909526550 1:76629930-76629952 GGGAAAAATAAATCCCTAGAAGG - Exonic
909888161 1:80968675-80968697 TTCAAAAATACATCCAGAGTAGG + Intergenic
911438275 1:97891256-97891278 GTGCTCAATTCATCCAGAGAGGG - Intronic
912012428 1:104984143-104984165 GTTAGAAATACATCAAGAGTAGG + Intergenic
912369185 1:109160036-109160058 GGGAAAAATAGACCCAGAGAGGG + Intronic
912395306 1:109337981-109338003 GTGAAAAATACATTCCGGTAGGG + Intronic
913290460 1:117267121-117267143 ATGAAACATACACTCAGAGATGG + Intergenic
915388014 1:155514183-155514205 GTCAAAAAAAGATCCAGAGCTGG + Intronic
915767807 1:158383971-158383993 GAAAAAGATACATTCAGAGAGGG + Intergenic
917063678 1:171068209-171068231 GGGAAAAACAAATCCATAGAAGG - Intergenic
917354561 1:174112558-174112580 GTGAAAAATACACACTGAGTAGG + Intergenic
917467034 1:175288794-175288816 TTGACAAATAGATCCAGGGAAGG + Intergenic
918434884 1:184501008-184501030 TTGATTAATACATCCTGAGATGG - Intronic
918482715 1:184996186-184996208 GAGAAAAAAACATCAACAGATGG + Intergenic
918948509 1:191102963-191102985 GTGATAAAAATATCTAGAGAGGG + Intergenic
919109626 1:193201507-193201529 GTAAAAAATAATCCCAGAGAAGG + Intronic
919534944 1:198775921-198775943 GCGAAGAATACATCCTGAGAAGG + Intergenic
919928184 1:202203678-202203700 GTGAGAAATACACCCAGGCAGGG + Intronic
920117465 1:203630626-203630648 CTGAAGAATCCTTCCAGAGAAGG - Intronic
920601494 1:207329252-207329274 GGGAGAAATGCATCCAGAGGAGG + Intronic
921863250 1:220061688-220061710 GAGAGAAACACATCCAGAGGTGG + Intronic
924079433 1:240378439-240378461 GAGAAAAACACAGCCAGACATGG - Intronic
924493147 1:244559766-244559788 GTGATAAATACACAAAGAGAAGG + Intronic
924562089 1:245165361-245165383 ATGAAGAATACAGGCAGAGAAGG + Intronic
1063729754 10:8682895-8682917 GTGAAAAATACCTACATATATGG - Intergenic
1064333029 10:14411589-14411611 ATGAAAAAAAAATCCACAGAGGG - Intronic
1064831815 10:19477058-19477080 TGGAAACATACATTCAGAGATGG + Intronic
1065330193 10:24587955-24587977 AAGAAAAATGCATCTAGAGAAGG + Intronic
1066151310 10:32622276-32622298 GAGAAAAAAAAATCCAGACAGGG - Intronic
1068391236 10:56399794-56399816 ATGTAAAATAAATCCAGTGAAGG + Intergenic
1069936762 10:71922772-71922794 CTGACAAATAGAGCCAGAGAAGG + Intergenic
1071320038 10:84445501-84445523 GTGTAATATACATACAGAAAAGG + Intronic
1072001270 10:91198105-91198127 GAGAAAAGTAAACCCAGAGAAGG + Intronic
1073867611 10:107822995-107823017 TTGCAAAATACATCCAGTGAAGG + Intergenic
1073982541 10:109171221-109171243 TTGAAAAATGCATGAAGAGAAGG + Intergenic
1075312562 10:121426963-121426985 TTGAATGATACATCTAGAGAAGG + Intergenic
1078561103 11:12373492-12373514 GGGAAAAATAAATGCAGAAAGGG + Intergenic
1079366814 11:19816966-19816988 GGGAGAAGTAGATCCAGAGAGGG - Intronic
1080376819 11:31722976-31722998 CTGCAAAAGCCATCCAGAGAGGG - Intronic
1081140302 11:39490100-39490122 GTGAAAGATACATGCAGACTTGG + Intergenic
1081440990 11:43080807-43080829 CTGACAAATACAGCCAGGGAAGG - Intergenic
1081795674 11:45817765-45817787 GTGAATATTCCATCTAGAGAAGG - Intergenic
1081838036 11:46174094-46174116 AAGAAAAATAAATACAGAGAAGG - Intergenic
1082897836 11:58211994-58212016 TGGAAAAAGACATCCAGAAATGG - Intergenic
1082923924 11:58525763-58525785 TTTAAAAATACCTCCAGTGAAGG + Intergenic
1082924044 11:58527161-58527183 GTGGAAAATACATCTGTAGAGGG + Exonic
1084525055 11:69691997-69692019 TTGAAAAATACAGCCAGGCATGG + Intergenic
1084738077 11:71118818-71118840 CTGAAATATACCTCCAGGGAAGG + Intronic
1086215681 11:84377816-84377838 GCCAAAAATAAATCCAGAGGTGG + Intronic
1086272349 11:85082589-85082611 GTGAAAAAACAATCAAGAGAAGG - Intronic
1086555142 11:88101070-88101092 GTGATAAATACATGAAGAGAAGG - Intergenic
1087783556 11:102328291-102328313 GAGAAAAATAGATCCATAAATGG + Intronic
1088058777 11:105618643-105618665 GTTAAAAATACATCCAAAGGGGG + Intronic
1088143517 11:106647951-106647973 GTGATAAATACGTTCAGACATGG - Intergenic
1089645762 11:119877656-119877678 GAGAAAAATAAACCCAGAGAGGG + Intergenic
1090698066 11:129268748-129268770 GTGAAAAATCCATTGAGACAAGG - Intronic
1090774898 11:129955408-129955430 GAGAAACAAACATCCAGAGATGG + Intronic
1093779924 12:23123159-23123181 GTGAAAAATACTTAGAGGGAAGG + Intergenic
1094819320 12:34212076-34212098 GTGTAAAAGACATCTAAAGATGG - Intergenic
1094821695 12:34231230-34231252 GTTAAAATTCCAGCCAGAGACGG - Intergenic
1095816685 12:46430426-46430448 CTGAAAAATATCTGCAGAGAGGG + Intergenic
1096169593 12:49456679-49456701 CTTTAAAATACATCCAGAGCTGG - Intronic
1097429939 12:59492727-59492749 GTGAAAAATACATTCATGTAAGG + Intergenic
1097608649 12:61788679-61788701 GAGTAAAATAAATGCAGAGAGGG + Intronic
1097957322 12:65499492-65499514 GTGATAAATACAACCACTGATGG - Intergenic
1101453220 12:104801033-104801055 CTGACAAATAGAGCCAGAGAAGG + Intergenic
1101657506 12:106736119-106736141 GTGACAAATAGATCCAAACACGG + Intronic
1101990839 12:109483468-109483490 GTGAAAAACACACACAGAAAGGG - Intronic
1103441688 12:120967726-120967748 ATGAAAAATGCATTCAGAAATGG + Intergenic
1104523625 12:129498007-129498029 GAGAAAAAAACAACCAGAGCTGG - Intronic
1104867674 12:131968421-131968443 GAGAAAAACACATAAAGAGACGG - Intronic
1105295819 13:19087377-19087399 GTGAAAAAGAGCTCCAGAGGAGG + Intergenic
1105767597 13:23577476-23577498 GTTAAAAACACTTTCAGAGAAGG - Intronic
1107708238 13:43127961-43127983 CAGAGAAATACATACAGAGAGGG - Intergenic
1107889316 13:44900416-44900438 ATGAAAACAACATCCAAAGATGG + Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108863502 13:54892707-54892729 GTAAAAAGAACATTCAGAGAAGG - Intergenic
1109861825 13:68209708-68209730 TAGAAATATATATCCAGAGAAGG - Intergenic
1109961819 13:69640937-69640959 GTGAAAATTACTGCCAAAGAAGG + Intergenic
1110519544 13:76458594-76458616 GTGAAAAATACTCCAAGACAAGG + Intergenic
1111636229 13:90907645-90907667 GAGAAGAATCCAGCCAGAGATGG - Intergenic
1111675937 13:91388811-91388833 GTGAATAATGAATCCAGATATGG + Intergenic
1112874404 13:104017809-104017831 GTGAAACATTCACCAAGAGATGG + Intergenic
1113105118 13:106763488-106763510 GTGATAAAGAAATTCAGAGAAGG + Intergenic
1113209778 13:107963192-107963214 TAGAAAAATGCATCCAGATAAGG + Intergenic
1114553851 14:23550506-23550528 GTGACATACAGATCCAGAGATGG + Intronic
1115537596 14:34387769-34387791 GCTGAAAATACATACAGAGAGGG - Intronic
1117227984 14:53682961-53682983 GTCATAAATACACACAGAGAAGG - Intergenic
1118060152 14:62128139-62128161 GAGGAAGATACATCTAGAGACGG + Intergenic
1119035382 14:71226061-71226083 TTGAAAAAAACATCCTGAGATGG - Intergenic
1122053569 14:99076923-99076945 GTGAAAAATGTTTCCATAGAAGG + Intergenic
1122581517 14:102774771-102774793 GTGAGAAATGCGTCCAAAGATGG + Intergenic
1123881057 15:24677614-24677636 GTGAAAATAACAACCTGAGATGG - Exonic
1124448870 15:29766233-29766255 GTGAAAAAAACAGCAAGAGTTGG + Intronic
1125171876 15:36774321-36774343 GGGAAAAAAACAACCAGAGTAGG - Intronic
1127072094 15:55297043-55297065 GCCACAAATGCATCCAGAGAGGG + Intronic
1130114582 15:80995793-80995815 ATAGAAAATACATCCAAAGATGG + Intergenic
1131333045 15:91520119-91520141 GTGATAAATACATCCAAAACAGG + Intergenic
1131728342 15:95251733-95251755 GTGCAGAATTCATCCAGAGTGGG + Intergenic
1131773554 15:95767848-95767870 GTGAAAAATAAAACCATAGCTGG - Intergenic
1131856079 15:96596356-96596378 GTGAAGGATTCATCCAGAAAGGG - Intergenic
1133382685 16:5344582-5344604 GGGAAAAAAACATCCCAAGAAGG - Intergenic
1133965422 16:10527703-10527725 CTGAAAAATTCAGACAGAGAAGG - Intergenic
1135713387 16:24738233-24738255 CTGAAAGGTACATTCAGAGAAGG - Intronic
1136783919 16:32923698-32923720 GGGAAAAATATGGCCAGAGAAGG + Intergenic
1136885864 16:33930108-33930130 GGGAAAAATATGGCCAGAGAAGG - Intergenic
1137536449 16:49330590-49330612 CTGAGGAATACATCCAAAGAGGG + Intergenic
1137993364 16:53182405-53182427 GTAAAAAATACATCCTGGGCTGG - Intronic
1138407384 16:56807367-56807389 AAGAAAAATACAGCAAGAGAAGG - Intronic
1139507368 16:67405817-67405839 GTGAAAAATTCTTCGATAGATGG + Intronic
1140198205 16:72873138-72873160 GTGAAAAATACGCCCATTGAAGG - Intronic
1141437832 16:84010749-84010771 GAGAAAAAGACATGGAGAGAAGG + Intronic
1142578576 17:926165-926187 GAGAAAAATAGAGACAGAGACGG - Intronic
1143074774 17:4332045-4332067 GTGAACAATGCATTCAGTGAAGG - Intronic
1147144195 17:38475854-38475876 GGGAAAAATATGGCCAGAGAAGG + Intronic
1149360527 17:55890280-55890302 GTGAAAAATCCAAGCAAAGATGG - Intergenic
1149946538 17:60933694-60933716 GTTAAAAATAAATCAAGACATGG - Intronic
1151375119 17:73683146-73683168 ATGAAAAAGACAGACAGAGACGG - Intergenic
1152414548 17:80150825-80150847 GAAAAAAATTCTTCCAGAGATGG - Intergenic
1152891283 17:82883032-82883054 GTGAAAGATACATCCAGCTAAGG - Intronic
1203170742 17_GL000205v2_random:146205-146227 TTGAAAAACCCATCCAGAGATGG - Intergenic
1153158786 18:2179603-2179625 GAGAAGAATCCAACCAGAGATGG + Intergenic
1153188950 18:2516963-2516985 GTGAAAAGCACTTCCAGAGGAGG + Intergenic
1155672313 18:28387240-28387262 TTGAATTATACATCCAGAGTGGG - Intergenic
1156861412 18:41840715-41840737 TTAAAAAATGCATCCAGAGTAGG + Intergenic
1158242251 18:55390159-55390181 GTGATAAATACTTCCAGATGTGG + Intronic
1159047892 18:63386692-63386714 GGGAAAAATACAGCCAGGGATGG + Intergenic
1160247841 18:77173903-77173925 GTGCAAAAGTCATCCACAGAGGG + Intergenic
1160284665 18:77530450-77530472 GTGAAAAATTCAGCCAGTCATGG - Intergenic
1161765765 19:6207708-6207730 TTGAAAAATGCAACCAAAGACGG + Intergenic
1163095168 19:15051980-15052002 CTGAAGAAGACATCCAGAAATGG + Intronic
1166641067 19:44495628-44495650 GTGAGCAAGGCATCCAGAGAGGG - Intronic
926551495 2:14306785-14306807 GTTAAACATTCATCCAGTGAAGG - Intergenic
926806788 2:16718479-16718501 GTTAAAAATAGATCCATAGAGGG - Intergenic
926859628 2:17295219-17295241 ATTACAAATACATCAAGAGATGG + Intergenic
927296739 2:21463595-21463617 GGGAAAAACTCATCCCGAGAAGG + Intergenic
927345852 2:22038684-22038706 GAGAGAAAAATATCCAGAGAAGG + Intergenic
927770577 2:25857397-25857419 ATGAAAACTATATGCAGAGATGG - Intronic
927823260 2:26287964-26287986 GTTTAAAATAAAGCCAGAGAGGG + Intronic
928328265 2:30337174-30337196 GAGAAAACTACATCTAGAGAAGG - Intergenic
928801714 2:35101946-35101968 GTGAAAAATATTTGCAGAGCAGG + Intergenic
929298160 2:40271498-40271520 GTGAAAAATAGGTTCAGTGAGGG - Intronic
933082401 2:78007080-78007102 ATGAAAAATAAAACCAGAGATGG - Intergenic
933260181 2:80123738-80123760 GTGAAATAACCACCCAGAGAAGG + Intronic
933420877 2:82043630-82043652 GTGAAAAAGAGACCCAGAGTGGG - Intergenic
937592053 2:123626412-123626434 CTACAAAATAAATCCAGAGAGGG + Intergenic
938168389 2:129053301-129053323 GGGAAAAAAACATACAGAAAGGG + Intergenic
938591233 2:132738133-132738155 GTGAAAAATAACTACAGAAAAGG - Intronic
938815117 2:134895005-134895027 GTGAAAAATATAGCCAAAAAAGG + Intronic
939295145 2:140253617-140253639 TTAAAAAATATGTCCAGAGATGG + Intronic
942208322 2:173646046-173646068 GACAAAGATAAATCCAGAGAGGG + Intergenic
944692524 2:202170784-202170806 GTGATGAAGACATCAAGAGAAGG + Intronic
944828860 2:203512441-203512463 GTAAGAAATCCAACCAGAGATGG + Intronic
944992739 2:205256170-205256192 TTAAAAAAAACATCCTGAGAGGG - Intronic
945322084 2:208436183-208436205 GTGAAAAATACAGCAGGAAAAGG + Intronic
946797479 2:223371280-223371302 GTGAATAATAAATGGAGAGAAGG + Intergenic
946797812 2:223374426-223374448 GTGAATAATAAATGGAGAGAAGG - Intergenic
1168950060 20:1791580-1791602 GTGTAAAATATATATAGAGATGG - Intergenic
1169763243 20:9120282-9120304 TTGAATAAGACATTCAGAGAGGG - Intronic
1169863615 20:10176527-10176549 GTGAAAAGTACATCCAGAGGAGG - Intergenic
1170798606 20:19571514-19571536 CTGAAAAATTTCTCCAGAGATGG + Intronic
1170917867 20:20645483-20645505 GAGAAAAATACATATAGAAAGGG + Intronic
1171084760 20:22227415-22227437 GTGAAGAAGACATTCAGAGCTGG + Intergenic
1172217469 20:33246367-33246389 GGGAAAATCATATCCAGAGATGG - Intergenic
1172460026 20:35110573-35110595 GTGAAAAGCACATCCACAGGGGG + Intergenic
1173574706 20:44104870-44104892 GAGAAAAATACAGTCAGAGGAGG - Intergenic
1176002378 20:62838378-62838400 GTGTTAAATACATCCAAACACGG + Intronic
1176326729 21:5508036-5508058 TTGAAAAACCCATCCAGAGATGG - Intergenic
1176401028 21:6312915-6312937 TTGAAAAACCCATCCAGAGATGG + Intergenic
1176436129 21:6676189-6676211 TTGAAAAACCCATCCAGAGATGG - Intergenic
1176460391 21:7003259-7003281 TTGAAAAACCCATCCAGAGATGG - Intergenic
1176483952 21:7385037-7385059 TTGAAAAACCCATCCAGAGATGG - Intergenic
1177950381 21:27528497-27528519 GTGTAAAATAAATGCAGAGTAGG - Intergenic
1178456169 21:32753708-32753730 GTGAAAAATACAGTCCTAGAGGG - Intronic
1179379245 21:40883214-40883236 ATGACAACCACATCCAGAGAGGG - Intergenic
1179397181 21:41051441-41051463 GTGAGAAATTAATCCAGACATGG + Intergenic
1179931982 21:44576598-44576620 GTTAAAAATAACTCCAGAGAAGG + Intronic
1181747661 22:24967056-24967078 GTAAAAAAAAGGTCCAGAGAGGG - Intronic
1182764666 22:32750185-32750207 GAGAAAAATAAATCAAGAGAAGG + Intronic
1183963178 22:41425036-41425058 GTTAAACATACAGCCAGACATGG - Intergenic
1184904168 22:47468690-47468712 AGGAAAAGTACACCCAGAGAGGG + Intronic
949284404 3:2383940-2383962 GTGATATATACATACACAGAAGG - Intronic
950080685 3:10219924-10219946 GAGAAAAAGACATCCAGGGGAGG - Intronic
950886768 3:16368928-16368950 GTTAAGAATACATCCAGAGCAGG - Intronic
951344309 3:21528164-21528186 TTGAAAAATAGATCCAGAAAGGG + Intronic
951477133 3:23118882-23118904 ATGATAAATACATAAAGAGATGG + Intergenic
953907149 3:46874116-46874138 GGGAAAGCGACATCCAGAGAAGG - Intronic
955621415 3:60868409-60868431 GTGTAATATACAGCAAGAGAGGG - Intronic
956576731 3:70760360-70760382 CTGCAAAATACATCCAGAATTGG - Intergenic
959289629 3:104457448-104457470 GTAAAAAACACACCCTGAGATGG - Intergenic
959460962 3:106624859-106624881 GGGAAAAATACAACCAGACCAGG + Intergenic
960827241 3:121802240-121802262 GTGAAAAAGCCATCCAGACCTGG + Intronic
960922335 3:122760006-122760028 TTGAAATATACATCCATGGATGG + Intronic
962101467 3:132347073-132347095 GTGAAACAGAGATCCAGAGAGGG - Intronic
963097529 3:141561064-141561086 TTGTAAAATGCATCCACAGAGGG + Intronic
963181774 3:142364432-142364454 GTGAAAAAAAAAATCAGAGAAGG - Intronic
963697917 3:148585176-148585198 GTTCCAAATACATCCACAGAAGG + Intergenic
964050440 3:152386318-152386340 GTGAAAAACACAATTAGAGAAGG - Intronic
964650119 3:159001822-159001844 GTGAGAAATCCATCCAGTGGAGG - Intronic
965178908 3:165375040-165375062 GGACAATATACATCCAGAGAAGG - Intergenic
967506684 3:190260463-190260485 GTGAGAAAGACATACATAGAGGG - Intergenic
968138289 3:196235207-196235229 GTGGAAAGAACATCTAGAGATGG + Exonic
968177893 3:196567345-196567367 GTGAAAAAGACATGAGGAGAAGG + Intronic
968724317 4:2235936-2235958 GTGAAAAAAAAATACAGAGGCGG + Intronic
969104949 4:4799875-4799897 GTGAAACATATATCCAGAAAAGG + Intergenic
969260355 4:6029468-6029490 GTGAAAAAGACACACAGAGTTGG + Intronic
970890525 4:21038926-21038948 GTGAAAAAAGCATCCTGTGAAGG + Intronic
970909894 4:21262626-21262648 GTAAAAAATAGGTCCAGAAAGGG - Intronic
971395970 4:26227841-26227863 GTGAAAAACTCAACCGGAGAAGG - Intronic
971707328 4:30062829-30062851 GTGAAACACATATCAAGAGAAGG - Intergenic
972721330 4:41702017-41702039 TTGAAAAATATATCAAGAAATGG + Intergenic
973032068 4:45358115-45358137 AAGAAAAATACAACCAGATATGG + Intergenic
973076649 4:45936169-45936191 GAGAAATAGACATCCATAGAAGG + Intergenic
973829136 4:54740934-54740956 TTGAAAAATAGATACAGAGAAGG + Intergenic
974389916 4:61252928-61252950 GAGAAAAAAGCATCCAGAAAAGG - Intronic
974616515 4:64290619-64290641 ATGAAAAATGCATACAGAAATGG - Intronic
974871347 4:67647476-67647498 CTGAAAAATAAATACAGAGTAGG - Intronic
975121363 4:70731966-70731988 TTGAAAAAATCATCCAAAGAAGG - Intronic
975618458 4:76271268-76271290 CTGGAAAATACTTCTAGAGATGG + Intronic
975763176 4:77637543-77637565 CTGAAAAATAAATCAAGAAAAGG - Intergenic
975792950 4:77974486-77974508 GTGAAAAGTAAATCCACAAATGG - Intergenic
975815373 4:78211327-78211349 TTTAAAAATACATCGAAAGATGG - Intronic
976472436 4:85445389-85445411 GTGATAAGTATATCCTGAGAAGG + Intergenic
977781487 4:100986251-100986273 GTGAAGAATCCAGCCAGAGATGG + Intergenic
979412148 4:120392746-120392768 GTGAAAAATTTACCCATAGAAGG - Intergenic
979896070 4:126158389-126158411 ATGAAAAGTACATCCAATGAAGG - Intergenic
980292959 4:130869416-130869438 GTGGAAAATATATCCTAAGAAGG - Intergenic
981968356 4:150634109-150634131 GGGAAAACTCCATTCAGAGATGG - Intronic
982248022 4:153374445-153374467 ATGAAAAATGCTTCAAGAGATGG + Intronic
982257380 4:153464209-153464231 ATGAAAAATAACTCCAGAGGAGG + Intergenic
982485744 4:155963821-155963843 CTGAAAAATAGAGACAGAGATGG - Intergenic
982736850 4:159015985-159016007 CTGAAAAAGAAATTCAGAGAAGG + Intronic
984241157 4:177220766-177220788 GTGAAAAATAAATGAGGAGAAGG + Intergenic
984848456 4:184129486-184129508 TTGAAAAATACACCTAGACATGG + Intronic
986365810 5:7029614-7029636 CAGAAAAATAGATCCAGAGAAGG - Intergenic
986638288 5:9846592-9846614 GAGTAAAGTACATTCAGAGAAGG - Intergenic
986777614 5:11032182-11032204 ATGAAAAGTAAATTCAGAGACGG - Intronic
987161394 5:15147699-15147721 ATGAAAAAGACATCCAGTAAAGG - Intergenic
987453299 5:18112874-18112896 GTGAAAAAAATATACAGAGTAGG + Intergenic
987732861 5:21799972-21799994 GTGAAGAATAGAGCTAGAGAAGG + Intronic
989137412 5:38168600-38168622 GAGAAAAAGACATCCAGAGGGGG - Intergenic
989581041 5:43033737-43033759 GAGCAAATTACATCAAGAGATGG - Intergenic
990176557 5:53114532-53114554 GAGAAAAATCCAGCCAGAGATGG - Intergenic
990439195 5:55827579-55827601 GTGAGAAATAAATTCAGGGAAGG - Intergenic
993043282 5:82839365-82839387 GTTAATAATACATGCAGAGCAGG - Intergenic
994201908 5:96986167-96986189 GCTACAAATACATCCACAGAAGG - Intronic
994374166 5:98999577-98999599 GTGAAAAATTCATCAGGAAAGGG - Intergenic
997316051 5:132937035-132937057 GGGAAAAAAACATTCACAGAAGG + Intronic
1000866288 5:166518732-166518754 GGGAAGAATCCAGCCAGAGATGG - Intergenic
1003156327 6:3598912-3598934 CTGATAAATAAATTCAGAGAAGG - Intergenic
1004231432 6:13837209-13837231 TTGACAAATAGAGCCAGAGAAGG + Intergenic
1006108228 6:31729256-31729278 GAGAAAAAGACATGCAGACAAGG + Exonic
1007395042 6:41572890-41572912 GAGAAACAGAGATCCAGAGATGG - Intronic
1007513414 6:42391967-42391989 GGGAGAAAGACATCCAGAGTTGG + Intronic
1007642511 6:43353815-43353837 GTGAAAACTACATCAAGATAGGG - Intronic
1009302073 6:62036605-62036627 GTTAAAGAAACATCAAGAGAAGG + Intronic
1009851438 6:69204609-69204631 TTGAAAAATACATGAAGAGCTGG + Intronic
1009910711 6:69923632-69923654 GGGAAGAAGACATCCATAGAGGG + Intronic
1010348589 6:74843239-74843261 GTGAAAAAAACCTACAGAGTGGG - Intergenic
1010438420 6:75863348-75863370 GTGGAAAATACACTCAGAGAGGG + Intronic
1012734353 6:102920072-102920094 TTGAGAAATAGATCCAGTGAGGG + Intergenic
1013040819 6:106431656-106431678 GAGAAAAATACACACAGAAATGG + Intergenic
1014488114 6:122025964-122025986 GTGGAAAAGACAACCAGACAGGG + Intergenic
1014668254 6:124266918-124266940 GTGAAAGATAAAGCCTGAGAAGG - Intronic
1014742414 6:125161263-125161285 GTGAAAATCTAATCCAGAGAAGG - Intronic
1015565681 6:134567986-134568008 GTGAAGGAGACATCCAGATAGGG - Intergenic
1016582003 6:145638533-145638555 TTAAAATATACATCCAGACATGG + Intronic
1017303796 6:152892927-152892949 GTGAAAAAAAAATTCAGACAGGG - Intergenic
1017394603 6:153982374-153982396 CTGAAAAAAACCTCCCGAGATGG - Intergenic
1017584847 6:155909340-155909362 AAGAAGAATCCATCCAGAGATGG + Intergenic
1018810741 6:167296116-167296138 GGGAAACACACATGCAGAGAAGG + Exonic
1019786216 7:2979259-2979281 GTGAAAACTGCACCCAGAAACGG + Intronic
1019948446 7:4349473-4349495 GTGAAAATTACAGACACAGAAGG - Intergenic
1020735044 7:11937874-11937896 GTGAAAAATCAATCCAAGGAAGG - Intergenic
1020817976 7:12929292-12929314 GAGAAAATTACAGCCAGGGAAGG + Intergenic
1021715206 7:23455427-23455449 GTGAGAAATACATTCAGAGAGGG - Intronic
1021852738 7:24824551-24824573 GTGAAGAAGTCATCCAGAGAGGG + Intronic
1022196254 7:28069983-28070005 GAGAGAAAGGCATCCAGAGAAGG - Intronic
1025854609 7:65266392-65266414 GTGAAAAAATTATCCTGAGATGG + Intergenic
1025962690 7:66237490-66237512 CTAAAAAATACATTCTGAGAGGG - Intronic
1028046858 7:86130922-86130944 GAGAAGAATCCGTCCAGAGATGG - Intergenic
1028918115 7:96282055-96282077 GTGAAAAATATTCCCAAAGAAGG - Intronic
1030815358 7:114029648-114029670 CTTAAAAATATATCCAGAGATGG + Intronic
1030846952 7:114429396-114429418 GAGAGAAATTCATCCAGAAAAGG - Intronic
1031324542 7:120377322-120377344 GTGAAAAATACATCCAGAGAAGG + Intronic
1031327781 7:120423275-120423297 GTGAAAGATACATTTGGAGAAGG - Intronic
1032248388 7:130232171-130232193 GAGAAGAATCCAGCCAGAGATGG - Intergenic
1033617557 7:143031723-143031745 GTAAAAAATAAATCCAAACAAGG + Intergenic
1033769028 7:144527781-144527803 GTATAAATTACATACAGAGAAGG + Intronic
1033981641 7:147172039-147172061 GTGAAGATCATATCCAGAGAGGG - Intronic
1035783447 8:2246274-2246296 ACTAAAAATACATCCAGAGGGGG - Intergenic
1035808676 8:2473312-2473334 ACTAAAAATACATCCAGAGGGGG + Intergenic
1036138592 8:6184994-6185016 GTGATAGATACTTCCTGAGAAGG + Intergenic
1036776266 8:11614836-11614858 GTGAAAGATACAAACTGAGAAGG + Intergenic
1037093807 8:14957383-14957405 ATGAAAAATACATCTAAAAAAGG - Intronic
1037363409 8:18097521-18097543 GAGAAGAATGCAGCCAGAGATGG + Intergenic
1038225641 8:25654667-25654689 GAGAAAAATAAAACCAGAAAGGG - Intergenic
1038275643 8:26118646-26118668 CTGAAAAGTACAGGCAGAGAGGG - Intergenic
1040782346 8:51124616-51124638 ATGAAAAATAGACACAGAGATGG - Intergenic
1041327353 8:56682566-56682588 TTGAACAATACATCCAAATATGG + Intergenic
1044711839 8:95066004-95066026 GTGAAGTATGCATCCACAGATGG + Intronic
1045261569 8:100579689-100579711 GGGAAAAATACATCTGGTGATGG + Intronic
1046261117 8:111769062-111769084 CTGAAAAATATATCCAAATAAGG + Intergenic
1046302608 8:112316819-112316841 GTGGAAAATAATTCCAGATATGG - Intronic
1046574710 8:116012961-116012983 GTGGAAAAAACAACCAGATACGG - Intergenic
1046698684 8:117374945-117374967 GTGAAAAATATATATAGCGAAGG + Intergenic
1048054501 8:130850457-130850479 GTTAAAGATGCCTCCAGAGATGG - Intronic
1048200933 8:132373347-132373369 GTGAAAATTACATGAGGAGATGG + Intronic
1048750810 8:137672305-137672327 CTGAGAAATACATTCAGAAATGG - Intergenic
1051723157 9:20061030-20061052 TTTAAAAATACATCCATAAATGG + Intergenic
1051859823 9:21611910-21611932 GTGAAAAATAGATGAAGAGCAGG - Intergenic
1052025677 9:23570980-23571002 GAGAAAACTCCATGCAGAGAGGG - Intergenic
1052407636 9:28082747-28082769 GAGAGAAAGAGATCCAGAGAGGG - Intronic
1053371930 9:37568913-37568935 ATGAAAAATAGCTCCAAAGAAGG + Intronic
1053882477 9:42610151-42610173 GTGACAAAAATATGCAGAGAGGG + Intergenic
1053890192 9:42684151-42684173 GTGACAAAAATATGCAGAGAGGG - Intergenic
1054221502 9:62417619-62417641 GTGACAAAAATATGCAGAGAGGG + Intergenic
1054229212 9:62491554-62491576 GTGACAAAAATATGCAGAGAGGG - Intergenic
1055371376 9:75603235-75603257 GTGAATAAAACATCCATTGAGGG + Intergenic
1059862776 9:118483519-118483541 GTGATAAAAACATCAAGAGGTGG - Intergenic
1062161676 9:135083774-135083796 GAGGAAAACAGATCCAGAGAGGG - Intronic
1062608103 9:137357433-137357455 GTACAAAATACATAAAGAGAAGG - Intronic
1203435389 Un_GL000195v1:132472-132494 TTGAAAAACCCATCCAGAGATGG + Intergenic
1185911360 X:3984040-3984062 GTCAAAAATACATACAGAAAAGG - Intergenic
1186297358 X:8165099-8165121 ATGAAAAAAACATCAAGAGATGG + Intergenic
1186623423 X:11265787-11265809 GTAAAAAATGCATCCTGAAATGG + Intronic
1186735664 X:12461317-12461339 GTGTAAAAAACTTCAAGAGAAGG + Intronic
1187359161 X:18608856-18608878 GTCAAAGAGACCTCCAGAGAAGG + Exonic
1187958654 X:24545915-24545937 GAGAAAAATCCAGCCAGAAAGGG + Intergenic
1188987523 X:36780772-36780794 GTGCAGAATACAACCAGTGAAGG - Intergenic
1189698427 X:43690918-43690940 GAGCAAAATAAATCCAAAGAAGG + Intronic
1193245351 X:79221914-79221936 GGGATAAAGACATCCAAAGAGGG + Intergenic
1193648602 X:84101272-84101294 GGGAAAAATGAATCAAGAGATGG - Intronic
1194960421 X:100228861-100228883 GGAAAAGATACATCCACAGATGG + Intergenic
1196199651 X:112871196-112871218 GTGTAAGAGACATCCAGTGAGGG - Intergenic
1196407151 X:115375574-115375596 GTGAAAAAAACATAAAGGGATGG + Intergenic
1196626875 X:117886814-117886836 GTGAAAAATTCCTCAAGAGGTGG + Intergenic
1197758516 X:130012550-130012572 ATGGAAGATACAACCAGAGAAGG - Intronic
1198094193 X:133362256-133362278 AGGAAAAATACAGACAGAGAAGG + Intronic
1198417416 X:136434639-136434661 CTGCATAATACTTCCAGAGAGGG - Intergenic
1198504404 X:137287204-137287226 ATGAAAAATCAATCCAGATATGG + Intergenic
1198562071 X:137861214-137861236 GTGAAAAATACATCTATGAAAGG + Intergenic
1201617259 Y:15914332-15914354 ATGAAAAATAGATTAAGAGATGG + Intergenic
1201771540 Y:17621270-17621292 TTGAAAAAAACATCCTGAGATGG - Intergenic
1201830015 Y:18284716-18284738 TTGAAAAAAACATCCTGAGATGG + Intergenic