ID: 1031325728

View in Genome Browser
Species Human (GRCh38)
Location 7:120394733-120394755
Sequence CTGTGAGACTAGAAGTAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031325719_1031325728 28 Left 1031325719 7:120394682-120394704 CCATGGTTAGCTAGCCCTACACC 0: 1
1: 0
2: 15
3: 25
4: 153
Right 1031325728 7:120394733-120394755 CTGTGAGACTAGAAGTAAGATGG No data
1031325721_1031325728 14 Left 1031325721 7:120394696-120394718 CCCTACACCCAGGAATAAGCAAG 0: 1
1: 0
2: 5
3: 23
4: 154
Right 1031325728 7:120394733-120394755 CTGTGAGACTAGAAGTAAGATGG No data
1031325726_1031325728 6 Left 1031325726 7:120394704-120394726 CCAGGAATAAGCAAGGGAGAGTA 0: 1
1: 0
2: 1
3: 17
4: 191
Right 1031325728 7:120394733-120394755 CTGTGAGACTAGAAGTAAGATGG No data
1031325718_1031325728 29 Left 1031325718 7:120394681-120394703 CCCATGGTTAGCTAGCCCTACAC 0: 1
1: 0
2: 15
3: 32
4: 118
Right 1031325728 7:120394733-120394755 CTGTGAGACTAGAAGTAAGATGG No data
1031325725_1031325728 7 Left 1031325725 7:120394703-120394725 CCCAGGAATAAGCAAGGGAGAGT 0: 1
1: 0
2: 2
3: 25
4: 227
Right 1031325728 7:120394733-120394755 CTGTGAGACTAGAAGTAAGATGG No data
1031325722_1031325728 13 Left 1031325722 7:120394697-120394719 CCTACACCCAGGAATAAGCAAGG 0: 2
1: 19
2: 181
3: 385
4: 976
Right 1031325728 7:120394733-120394755 CTGTGAGACTAGAAGTAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031325728 Original CRISPR CTGTGAGACTAGAAGTAAGA TGG Intronic
No off target data available for this crispr