ID: 1031329290

View in Genome Browser
Species Human (GRCh38)
Location 7:120443997-120444019
Sequence CTAAGGAAACAGCAGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 1, 2: 4, 3: 53, 4: 446}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031329290 Original CRISPR CTAAGGAAACAGCAGGAGCA AGG (reversed) Intronic
900187134 1:1337792-1337814 CCAAGTACACAGCAGGAGCATGG + Intronic
901003607 1:6161080-6161102 CTCAGGAAACAGCAGTGGCCAGG + Intronic
901574679 1:10191358-10191380 ACAGAGAAACAGCAGGAGCAAGG + Intergenic
901621463 1:10591709-10591731 CAAAGAGAACATCAGGAGCATGG - Intronic
902215251 1:14930706-14930728 ACAAGGAAACTGCAGGAGGAAGG - Intronic
902239932 1:15081720-15081742 CCAAGGGAACGGCAGGTGCAGGG + Intronic
902626620 1:17680243-17680265 CTGAGGAAACAGCAGGATGCTGG - Intronic
903787323 1:25870083-25870105 GAAAGGAAAAAGCAGGGGCAGGG + Intronic
904383640 1:30127737-30127759 CTAAAGAATCAGAAGGAGCATGG - Intergenic
904637901 1:31898623-31898645 CAAAGGAAACAGAAGTAACATGG + Intergenic
905866587 1:41380300-41380322 CTATGGAAACAGCAGGGGCTTGG - Intronic
906515168 1:46434694-46434716 CTAAGAGCACAGCAGGGGCAGGG - Intergenic
906616164 1:47234267-47234289 CTGAGGAAACAGCTGGACCAAGG + Intergenic
906724668 1:48035578-48035600 CAAAGGAAAGAGCAGGGGGAGGG + Intergenic
907629848 1:56069526-56069548 CAGTGGAAAGAGCAGGAGCAAGG + Intergenic
907779650 1:57554122-57554144 CTAAGGAGACAACAGAAGAAGGG + Intronic
909048331 1:70737363-70737385 CTAATGACACTGCAGGAGGAGGG + Intergenic
909566377 1:77057741-77057763 TTGAGGAAACAACAGAAGCAGGG - Intronic
911874069 1:103136338-103136360 CTCAGGAAACAACAGGTGCTGGG - Intergenic
912179057 1:107195733-107195755 CAAAGGAATCAGCAAGTGCAAGG - Intronic
912509246 1:110177038-110177060 CAAAGGGAACTGCATGAGCAAGG + Intronic
912694720 1:111832599-111832621 CTAGGTAACCAGCAGGACCAGGG - Intronic
912769345 1:112448780-112448802 CTAAAGAAACAGCATTAGAAAGG - Intronic
912905019 1:113695829-113695851 CTATGGAAACAGTAAAAGCATGG + Intergenic
912949318 1:114109935-114109957 CTAAAGACACAGAAGGGGCAGGG + Intronic
913237689 1:116799000-116799022 CTCAGGCAACAGCAGCAGCAGGG - Intergenic
913682317 1:121198076-121198098 CTAAGGAACAAGCAGGAAAATGG + Intronic
914034154 1:143985697-143985719 CTAAGGAACAAGCAGGAAAATGG + Intergenic
914155294 1:145082273-145082295 CTAAGGAACAAGCAGGAAAATGG - Intronic
914972599 1:152324168-152324190 GGAAGGCAAGAGCAGGAGCAGGG - Intronic
915938559 1:160103623-160103645 CTAGGGAAACAGGAGGAAGAAGG - Intergenic
916262194 1:162853226-162853248 GTAATGAAAGAGCATGAGCAAGG + Intronic
916666560 1:166973063-166973085 ATGAGGAGAAAGCAGGAGCAGGG + Intronic
917292969 1:173490304-173490326 ATAGGGAAACAACAGGAGCCGGG - Intergenic
918995107 1:191748443-191748465 CTAAAGCAACAGCAGGATAATGG + Intergenic
919079604 1:192854353-192854375 GTAAGAAAACAGCAGGAGAAGGG - Intergenic
919170875 1:193952489-193952511 CTAAGGAGACTGCAAGAGCTGGG - Intergenic
919537801 1:198810074-198810096 AGAAGGAGACAGCAGGAGCCAGG - Intergenic
920037186 1:203073839-203073861 CTAGGGTAAGAGCAGGATCATGG + Intronic
920039249 1:203085221-203085243 CTGAAGAAAGATCAGGAGCAAGG - Intronic
920469630 1:206216587-206216609 CTAAGGAACAAGCAGGAAAATGG + Intronic
921112508 1:212052701-212052723 TTAAGGTAACAGAAGAAGCAGGG - Intronic
921137113 1:212271494-212271516 TAAGGGAAACAGCATGAGCAAGG - Intergenic
921427315 1:215019399-215019421 CTAGAGAAACACCATGAGCAGGG + Intronic
921558912 1:216633273-216633295 CGGAGGAGACAGCATGAGCAAGG + Intronic
922067010 1:222154146-222154168 CTGAGGACAGTGCAGGAGCACGG - Intergenic
922205416 1:223442218-223442240 CTAAGGAAAGGGATGGAGCATGG - Intergenic
922608172 1:226904137-226904159 CCAAGGAATGAGCAGGAGGAGGG - Intronic
923097290 1:230785551-230785573 ACATGGAAAAAGCAGGAGCAGGG - Intronic
923103430 1:230835890-230835912 GTAAGGACACAGCAGGAAGAGGG + Intergenic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
923600416 1:235397996-235398018 CAAAGCAGACAGAAGGAGCAAGG - Intronic
924282432 1:242451865-242451887 ATAAGGTACTAGCAGGAGCATGG - Intronic
924886954 1:248229213-248229235 CTAGGGAACCAGCAGGAGCAGGG + Intergenic
924955842 1:248925841-248925863 CAAAGGAAAGAGCAGGATCCTGG - Intergenic
1063156041 10:3379942-3379964 TCCAGGTAACAGCAGGAGCAGGG + Intergenic
1063435644 10:6027479-6027501 ATAAGGCAAGAGCAGCAGCATGG + Intronic
1063978773 10:11437493-11437515 CTTAGGAAGCAGCAGGCTCAGGG - Intergenic
1064574395 10:16729783-16729805 ACAAGGAAACACCAGGGGCATGG - Intronic
1065943034 10:30582313-30582335 CTCAAGAAACAGCAGCAACAAGG + Intergenic
1066412970 10:35191849-35191871 CTAAGGAACCAGCTGGAGTCAGG - Intronic
1066760265 10:38742141-38742163 CTAGAGAAACAGCAGGGCCAGGG - Intergenic
1067348895 10:45457910-45457932 CCAAGGGAAGAGGAGGAGCAGGG - Exonic
1067479292 10:46584867-46584889 CTCGGGAAACAGGAGGGGCAGGG - Intronic
1067533274 10:47089993-47090015 GTAAGGCAAGAGCAGAAGCAGGG - Intergenic
1067615447 10:47756934-47756956 CTCGGGAAACAGGAGGGGCAGGG + Intergenic
1069625425 10:69864975-69864997 CTGAGGAAGCAGCAGGTGCATGG + Intronic
1070333633 10:75435724-75435746 CAAAGGAAACAGGAGCACCAAGG - Intronic
1070535543 10:77374703-77374725 CTAAAGAAACTGCAAGAGAAGGG - Intronic
1071368096 10:84922058-84922080 CTTAGTAAAGAGCAGGTGCAGGG + Intergenic
1072444370 10:95485557-95485579 ATAAGGAGACAGCAGGATGAGGG + Intronic
1072826247 10:98609781-98609803 CATAGGAAACAGCAGGAGCCTGG - Intronic
1072899553 10:99394959-99394981 CAAAGCAAACAGGAGGATCAGGG + Intergenic
1073703244 10:105954154-105954176 CAAAGGAAAGAACAGGAGGAAGG + Intergenic
1073925452 10:108509855-108509877 GTCAGGAAACAGCAGGTGCTGGG + Intergenic
1074851855 10:117445438-117445460 GGAGGGAAACAGCAGGATCAAGG - Intergenic
1075614407 10:123881085-123881107 CCAAGGGGCCAGCAGGAGCATGG - Intronic
1076273361 10:129175697-129175719 TTAAGGTATCAGCAGGACCAGGG + Intergenic
1076314055 10:129528450-129528472 GGAAGGAGACAGCAGTAGCACGG + Intronic
1076520590 10:131078495-131078517 TTAAGGAGGCTGCAGGAGCAGGG - Intergenic
1077177485 11:1197330-1197352 CTGAGGACCCAGCAGGAGTAGGG - Intronic
1077280433 11:1742538-1742560 CTAGGGGAGCAGCAGGAGGAAGG + Intronic
1077938729 11:6817855-6817877 CTAAGGAGCCAGCAGGAGCCAGG + Intergenic
1078843484 11:15100876-15100898 CCAAGGAGGCAGCAGAAGCAGGG - Intergenic
1078934448 11:15939286-15939308 CTAAGGAAACATCAGACCCATGG - Intergenic
1079428220 11:20363864-20363886 CTCACGACGCAGCAGGAGCAGGG - Exonic
1080646026 11:34188308-34188330 CTGAGGACACAGCAGGAACAGGG + Intronic
1080974858 11:37326581-37326603 CTGAGGGAACAGCAGGTGCAAGG - Intergenic
1080975970 11:37340935-37340957 CAAAGGGAACAGCAAAAGCATGG - Intergenic
1082821690 11:57548288-57548310 CAGAGGAAACAGCAGGTGCAAGG - Intronic
1083709474 11:64539232-64539254 CTGAGGCGACAGGAGGAGCAGGG + Intergenic
1084612432 11:70212181-70212203 GAGAGGAAACAGCAGGGGCAAGG - Intergenic
1085376365 11:76065822-76065844 CTAAGGAAACAGGCTGTGCATGG - Intronic
1085454059 11:76655972-76655994 CTAAGGGGAAAGCAGGAGCTTGG - Intergenic
1085826520 11:79853446-79853468 CTGAGGGAACAGCACGAGCAGGG - Intergenic
1085849752 11:80106395-80106417 CTCAAGACACAACAGGAGCATGG + Intergenic
1086051936 11:82602651-82602673 CTTAGGAACCAGCATGTGCAAGG - Intergenic
1087515437 11:99154176-99154198 GTGGGGAAGCAGCAGGAGCAGGG + Intronic
1089452007 11:118605433-118605455 CCAAGGCAAAAGCAGGAGTATGG + Intergenic
1089636637 11:119818098-119818120 AAAAGGAAACAGCAGCAGGAAGG + Intergenic
1089899805 11:121968592-121968614 ATATGGGCACAGCAGGAGCAGGG - Intergenic
1090470890 11:126980184-126980206 CTAAGGGAACAGCATAAGCAAGG + Intronic
1090540519 11:127698266-127698288 CTAAGGAACCTACAGGAGAATGG - Intergenic
1091116176 11:133015821-133015843 AGGAGGAAACAGCAGGAGCAAGG - Intronic
1094656203 12:32421686-32421708 GTAAGGCAACAGCAGAAGAAAGG - Intronic
1094723863 12:33092384-33092406 CTAAAGAAACAGCAAGACCTAGG + Intergenic
1095986164 12:48001202-48001224 CCAAGGCAATAGCAGCAGCAGGG + Intronic
1096546641 12:52344705-52344727 CAAATGAAACAGGAGGAGCAAGG + Intergenic
1098014985 12:66095082-66095104 GTCAGGAAACAGCAGGTGCTGGG - Intergenic
1098147959 12:67516900-67516922 ATAAGGAAACAGAGGGAACAGGG + Intergenic
1099599919 12:84721928-84721950 CTGAGAAAACTGCAGAAGCAAGG + Intergenic
1100005487 12:89890525-89890547 CTAAGGAATTAGCAGGAGTCAGG + Intergenic
1100332373 12:93596530-93596552 CAAAGGAAACTGCAGGGGCTGGG + Intergenic
1101739015 12:107485363-107485385 CCTAGGACACAGCAGGAACAAGG - Intronic
1102048482 12:109845310-109845332 CTTAGGAAACAGCCCAAGCACGG + Intergenic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1102570847 12:113826072-113826094 CCAAAGGAACAGCAGGTGCAAGG - Intronic
1103038738 12:117677408-117677430 GTAAGGACACAGCAAGAGGACGG + Intronic
1103403550 12:120659372-120659394 CCAATGAAACAGGAAGAGCAGGG - Intronic
1103825192 12:123732324-123732346 CTAAGGCAGAGGCAGGAGCAGGG - Intronic
1104515887 12:129426278-129426300 GGAAGAAAACAGCAGGAGAAAGG + Intronic
1104647608 12:130508462-130508484 CAATGGAATCAGCAGGTGCAGGG - Intronic
1105444363 13:20439903-20439925 CTGAGAAAACAGCGGAAGCAGGG + Intronic
1106634502 13:31512853-31512875 CTAAGGCAAAAGCAGGAAAAAGG + Intergenic
1107015604 13:35706103-35706125 CTAAAGACACAGGAGGAGAAAGG + Intergenic
1107555437 13:41513480-41513502 CTGAGGACACAGCATGAGGACGG + Intergenic
1107901547 13:45020325-45020347 CTCAGGAAACACAAGAAGCAAGG + Exonic
1108555178 13:51584612-51584634 CTGAGGAGACTGCTGGAGCACGG - Exonic
1109443579 13:62405519-62405541 CTCAGGAAGCAACAGGAGGAGGG - Intergenic
1110164890 13:72429484-72429506 CTGAGGAAACAGCAAGTGCTTGG + Intergenic
1110512393 13:76366335-76366357 ATATGGCAAAAGCAGGAGCAAGG - Intergenic
1110683317 13:78342020-78342042 TTGAGGAAGAAGCAGGAGCATGG - Intergenic
1113017879 13:105848774-105848796 CCCAGGAAACAACAGTAGCATGG + Intergenic
1114100145 14:19372852-19372874 CCAAGGAAAAAGCAGAAGGACGG - Intergenic
1114345668 14:21792056-21792078 CTAAGGACACAGCAGAAGAACGG + Intergenic
1114386957 14:22265544-22265566 GGAAGGGAACAGCAGGAGGAGGG + Intergenic
1114650491 14:24281458-24281480 GGAAGGAGACAGCAGGAGAATGG + Intergenic
1114713785 14:24804174-24804196 CTGTGGAAACAGCAGAAGGAAGG - Intergenic
1114716463 14:24830856-24830878 CTAAGGAAACTGAAAAAGCAAGG + Intronic
1115072804 14:29346273-29346295 CTAAGGTAACAGCAGGTGAAAGG - Intergenic
1115701028 14:35953186-35953208 TTGAGAAAACAGCAGAAGCAAGG + Intergenic
1115733964 14:36303276-36303298 CTAAAGAAAGAGCTGGAGAAAGG + Intronic
1115742077 14:36399215-36399237 TTAAGGGAACAGCAGGGTCAGGG - Intergenic
1118618906 14:67596771-67596793 CAAAGGAAACATCAGGGGCAAGG - Intronic
1119012604 14:71010966-71010988 CAATGGAAACAGTAGGAGGAGGG + Intronic
1119127568 14:72141840-72141862 CTAAGGAACCATAAGGAACATGG - Intronic
1119782044 14:77282402-77282424 CTATAGAAACTGCAGGGGCAGGG - Intronic
1121111324 14:91315126-91315148 CTAAGGTACAAGCAGGAGAAAGG - Intronic
1121414609 14:93770484-93770506 CAGAGGAAACAGCATGTGCAAGG - Intronic
1121711436 14:96041650-96041672 CACAGGACACACCAGGAGCAGGG - Intronic
1121827615 14:97023217-97023239 CAAAGGTCACAGCAGGTGCAGGG - Intergenic
1122408413 14:101513733-101513755 CTAGGGAGACAGCAGCAGCATGG - Intergenic
1122966006 14:105126366-105126388 CCAAGGAGCCAGCAGGAGCCAGG + Intergenic
1124998036 15:34743216-34743238 CAAAGGAAATAGCTTGAGCATGG - Intergenic
1125478698 15:40065063-40065085 CTGAGAGAACAGCATGAGCAGGG + Intergenic
1127054804 15:55120722-55120744 CAAATGAAACAGAGGGAGCAAGG - Intergenic
1127370127 15:58331404-58331426 CTAGGGAGACAGTAGGAGCCGGG - Intronic
1129998525 15:80027327-80027349 CTAAGGACACACCAGGCCCAGGG - Intergenic
1130271687 15:82454170-82454192 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130464035 15:84181557-84181579 CAATGGAAAGAGCAGGAGAAGGG + Intronic
1130474836 15:84255487-84255509 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130482252 15:84369543-84369565 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130488649 15:84413276-84413298 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1130500232 15:84491984-84492006 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1130507787 15:84562463-84562485 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1130586331 15:85186189-85186211 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1131887368 15:96931087-96931109 ATAAGAAAACAGCAGGAGTCAGG - Intergenic
1132428119 15:101737776-101737798 CAATGGAAAGAGCAGGAGAAGGG - Intronic
1133288345 16:4701786-4701808 CTATGGAAACAGCTGCTGCACGG + Intronic
1134467771 16:14494614-14494636 CTAAGGAGGAAGCAGGAGAAGGG + Intronic
1135993020 16:27228948-27228970 CTCAGAGAGCAGCAGGAGCAGGG - Intronic
1136266981 16:29127656-29127678 CTAAGCAAAGAGCAGGGGCAGGG + Intergenic
1137398864 16:48136771-48136793 CAAAGGAAACAGCAATTGCAAGG + Intronic
1137429435 16:48406620-48406642 GTAATGATACTGCAGGAGCATGG - Intronic
1138222529 16:55265093-55265115 CAAAGAAAACAGGAGGGGCAAGG + Intergenic
1138515397 16:57533193-57533215 GAAAGGGCACAGCAGGAGCACGG + Intronic
1139308826 16:66011196-66011218 CCCAGGAAACAGAGGGAGCATGG - Intergenic
1140434549 16:74935512-74935534 CTAAGGGGTCAGCTGGAGCAAGG - Intronic
1140574963 16:76157009-76157031 CTAAGGAAACACCAGGAATTTGG - Intergenic
1141859486 16:86706714-86706736 CTAAGGACACAGGATGAGAAAGG - Intergenic
1142070269 16:88087979-88088001 CTAAGCAAAGAGCAGGGGCACGG + Intronic
1142676972 17:1519686-1519708 CAAAGGGAAGAGGAGGAGCAGGG + Exonic
1143711143 17:8736119-8736141 CTAGGGAAATAGCAGGAGTTAGG + Intronic
1144307644 17:13983710-13983732 CTAAGAAAGCTGCAGGAACAAGG + Intergenic
1144431464 17:15196022-15196044 CTAAGCAAAAAGCAAGAGGAAGG + Intergenic
1145193197 17:20866283-20866305 CTCAGGCACCAGCAGGAGGAGGG + Intronic
1145276999 17:21437511-21437533 CAGAGGCAGCAGCAGGAGCAGGG - Intergenic
1145298819 17:21614804-21614826 CTCAGGCACCAGCAGGAGGAGGG - Intergenic
1145723300 17:27091542-27091564 CTCAGGCACCAGCAGGAGGAGGG - Intergenic
1146413575 17:32610907-32610929 ATAAGGAAGCAACAGGGGCAGGG - Intronic
1147849140 17:43427692-43427714 GTAAGGTATCAGCAGGAGCCTGG + Intergenic
1148148283 17:45379776-45379798 ATAAGTAATCAGCAGGTGCAGGG - Intergenic
1148219074 17:45849650-45849672 CTAGGGAACCAGCAGGGGGAGGG - Intergenic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1148440808 17:47710836-47710858 CTAAGCAGAAACCAGGAGCATGG - Exonic
1148572482 17:48681224-48681246 CTCAGAAAACAGAAGTAGCATGG - Intergenic
1149039264 17:52168473-52168495 CAAAGGCAAAAGCAGGGGCAGGG + Intergenic
1151510370 17:74555263-74555285 CTCAGGAAACAGAATGAGAAGGG - Intergenic
1152190877 17:78886526-78886548 GTGCAGAAACAGCAGGAGCACGG + Intronic
1152884214 17:82839774-82839796 CTCAGGACCCAGCAGGTGCATGG - Intronic
1152980609 18:272767-272789 CTAAGGAGAGAGCAAGAGCAGGG + Intergenic
1153660943 18:7325732-7325754 CTGAGGGAACAGAAGGTGCAAGG + Intergenic
1156386396 18:36609125-36609147 CTAAGAAAAAAACAGGAGGAGGG + Intronic
1156675188 18:39519634-39519656 TCAAAGAAAAAGCAGGAGCATGG - Intergenic
1156725434 18:40120869-40120891 CTAAAGAACAAGCAGGGGCAAGG - Intergenic
1157680455 18:49601492-49601514 CTACGGGAACAGGAGGTGCAAGG + Intergenic
1157738436 18:50071166-50071188 CAGAGGAACCAGCATGAGCAAGG - Intronic
1158173891 18:54631863-54631885 CTAAGCAAACAGAAGGATTATGG - Intergenic
1158799699 18:60891949-60891971 CTAAAGAAACAGAATAAGCAGGG + Intergenic
1161440953 19:4291398-4291420 CCATGGAAACAGCAGAAGTAGGG + Intergenic
1163665695 19:18603206-18603228 CCAAGGAAGCAGCAGGAAAAAGG + Intronic
1163710436 19:18843351-18843373 CTGAGGGAACAGCAGGTGCAAGG + Intronic
1164242609 19:23403119-23403141 CTAAGTCCACAGCAGGAGTATGG - Intergenic
1165098901 19:33426740-33426762 CTGAGGAAACAGGAGGAGCTGGG + Intronic
1166798593 19:45442828-45442850 CTGAGGAACCACCAGCAGCAGGG + Intronic
1167527538 19:49994438-49994460 CCAAGGATACAGCTGGGGCAAGG - Intronic
1168153006 19:54459042-54459064 CGAAGGACACTGCAGGGGCATGG - Intronic
1168345522 19:55648613-55648635 CTAAGGAAGAGGCAGGTGCAGGG - Exonic
924959103 2:17867-17889 CAAAGGAAAGAGCAGGATCCTGG + Intergenic
925167951 2:1730500-1730522 CTAAGTAAACAGGAAGAGCCGGG + Intronic
925183630 2:1832519-1832541 TTTAGGAAACAGAATGAGCAGGG - Intronic
926138891 2:10356753-10356775 CTGAGGGAACACCAAGAGCATGG - Intronic
927339499 2:21966331-21966353 CTGAGCAAGCAGCAGGAACAAGG + Intergenic
927551901 2:24008791-24008813 CTTATGAAAAAACAGGAGCAAGG - Intergenic
927701914 2:25274501-25274523 CAGAGGAAACAGCACCAGCAAGG - Intronic
927871795 2:26628726-26628748 CTGAGAAGACAGGAGGAGCAGGG - Intronic
927890291 2:26743876-26743898 CAAAGCAAATAGCAGTAGCAGGG - Intergenic
930505403 2:52277202-52277224 CTAAGAAAACCACAGGAGGAAGG - Intergenic
931431768 2:62214224-62214246 CTGTGGGAACAGCATGAGCAGGG + Intronic
931701322 2:64911441-64911463 TTGAGAAAACAGCAGAAGCAGGG + Intergenic
931745241 2:65286211-65286233 CTTTGGAAATGGCAGGAGCAGGG + Intergenic
932089338 2:68791004-68791026 CGAAGGAAACAGCAAGTGCAAGG - Intronic
933726636 2:85430900-85430922 CCAAGGCAACAGCAGGGGCCTGG + Intronic
935538860 2:104326170-104326192 CAAAGGAAACTACAGGAGCCAGG + Intergenic
935747128 2:106198350-106198372 CTAAGGAAATAGCAAAGGCAAGG + Intergenic
936617475 2:114062865-114062887 CTAAGGAGAAAGCAGCAGGAAGG - Intergenic
937072666 2:119076055-119076077 CTATTGAGGCAGCAGGAGCAGGG - Intergenic
938162892 2:129002336-129002358 CTAAGAAAAGAGGAAGAGCATGG - Intergenic
940282093 2:151999090-151999112 ATAAGGAATCAGTAGGAACAGGG + Intronic
940377108 2:152969270-152969292 TTAAGGAAGTAGCAGGAGCCAGG - Intergenic
940553613 2:155193801-155193823 CAAAGGACACAGCTGGTGCAGGG - Intergenic
940894659 2:159069252-159069274 CTGATGGAACAGCAGGAACAAGG - Intronic
941629267 2:167866055-167866077 CAAAGGAAACAGCATATGCAAGG - Intergenic
942293506 2:174495806-174495828 CTAAGGAGACGGCTGGTGCAAGG + Intergenic
942903424 2:181151518-181151540 CTCCGGAAGCAGCAAGAGCATGG + Intergenic
943477735 2:188379840-188379862 CAAAGGAAACACCATAAGCAAGG - Intronic
944328340 2:198434155-198434177 AGAAGCAGACAGCAGGAGCAAGG - Intronic
944465727 2:199997708-199997730 CTGAGGAATCTGCAGGACCAAGG + Intronic
944469350 2:200036304-200036326 GTAAGGAAGCAGCAGGACCCTGG - Intergenic
944551014 2:200844782-200844804 CCAAGCACACAGCAGGACCAGGG + Intergenic
944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG + Intronic
944792138 2:203142011-203142033 CTAAGGCAACAGGGGGAGTAGGG - Intronic
946046865 2:216828603-216828625 CAAAGGAAGCAGGTGGAGCAGGG + Intergenic
946068406 2:217010060-217010082 CTATGAAAACAGCAGGAGATGGG + Intergenic
947610944 2:231524876-231524898 AGAGGGAAACAGCAGGAGGAGGG - Exonic
947801197 2:232929147-232929169 CTGAGGAAACCCCAGGGGCAGGG + Intronic
947931727 2:233970311-233970333 GTAGGCAAACAGCAGGAGGAAGG - Exonic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
1168749765 20:274216-274238 GGAAGGGAACACCAGGAGCAAGG - Intronic
1168756432 20:321618-321640 CAGAGGAAACAGCAAGTGCAAGG - Intergenic
1168812872 20:717660-717682 CTGAGGAAACAGCACGTGCAAGG - Intergenic
1169666449 20:8041876-8041898 CTGTGGAAACAGCAGGGACATGG - Intergenic
1169880274 20:10340140-10340162 ATATGGCAAGAGCAGGAGCAAGG + Intergenic
1171388567 20:24786585-24786607 CTCAGGAAGCAGCTGGAGAAGGG - Intergenic
1172178474 20:32986619-32986641 CTAAGGGAACAGCACGGGAAAGG + Intronic
1172232854 20:33348608-33348630 CTGAGGAGCCAGAAGGAGCAGGG + Intergenic
1172504380 20:35450638-35450660 CTAAGGGAACTGCAGGAGAGGGG - Intronic
1172623838 20:36336332-36336354 CAGAGGAAACAGCAAGCGCAAGG - Intronic
1173433357 20:43011042-43011064 CTAACGAATAAGCAGGAGGATGG - Intronic
1173650985 20:44664050-44664072 CTTAGGATACAGAAGGAGCCAGG + Intergenic
1174061935 20:47839159-47839181 CTGAGGAAAGAGGAGGAGCCAGG + Intergenic
1174069573 20:47890072-47890094 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1174188832 20:48725506-48725528 GGAAGGAAACAGCAGGTGTATGG + Intronic
1174289562 20:49498244-49498266 CTGTGGAAATAGCAGGAGCAAGG - Intergenic
1174499754 20:50975915-50975937 ACAAGGACACAGCATGAGCAAGG - Intergenic
1177155883 21:17501011-17501033 CAAAGGAAACAGCCACAGCAGGG + Intergenic
1177342272 21:19819003-19819025 ATATGGCAAAAGCAGGAGCATGG - Intergenic
1178746414 21:35254987-35255009 CTAAGTGATCAGCAGGATCAGGG + Intronic
1179551164 21:42144914-42144936 GTATGGAAACAGAAGGAGGAAGG + Intergenic
1181333229 22:22110964-22110986 CTCAGGACAGAGCAGGGGCATGG + Intergenic
1181355519 22:22294048-22294070 CTAGGGCAGCAGCAGGGGCAGGG + Intergenic
1181562170 22:23711842-23711864 TTAAGGAAACAGGCTGAGCATGG + Intergenic
1181922219 22:26329175-26329197 CTAAGGAAACAGGCTGGGCACGG + Intronic
1181989050 22:26822715-26822737 ATAAGGAAGCAGCAGGAGAGGGG - Intergenic
1182015790 22:27038648-27038670 CAGAGGAAACAGCAGGTGCAAGG + Intergenic
1182127884 22:27829393-27829415 CTGAGGGAACAGCATGAGGAAGG + Intergenic
1183334962 22:37241283-37241305 CTCAGGCAAGAGCAGGAGCTGGG - Intronic
1183796283 22:40121087-40121109 GGAAGGAAGCATCAGGAGCAGGG + Intronic
950722045 3:14890393-14890415 CGGAGGAAACAGTGGGAGCATGG - Intronic
950837605 3:15935774-15935796 AAAAGGAAACAGAGGGAGCAAGG - Intergenic
952295813 3:32061003-32061025 CGAGGGACAGAGCAGGAGCAGGG - Intronic
952859346 3:37799899-37799921 CTAAGGAAGGAACAGCAGCATGG - Intronic
953588868 3:44232149-44232171 CCAAGGGAACGGAAGGAGCAGGG - Intergenic
953589447 3:44237483-44237505 TTGAGAAAACAGCAGAAGCAAGG - Intergenic
953693105 3:45136378-45136400 CTAAGGAAGAAGGAGGAGGATGG + Intronic
954008209 3:47610218-47610240 CAAATGGAACAGCAGCAGCATGG - Exonic
954387223 3:50250480-50250502 CAAAGAGAACAGCATGAGCAGGG + Intronic
954763624 3:52895741-52895763 CTATGGAAACAGCCAGAGCTAGG + Intronic
955295258 3:57729075-57729097 CCAAGAAAACAGCAAGGGCAAGG + Intergenic
955644935 3:61126974-61126996 CCAAGAAAAAAGCAGGAGGAAGG + Intronic
955733770 3:62015303-62015325 CTGCTGAAACAGCAGGAGAAAGG + Intronic
956173210 3:66449475-66449497 CTAATGGAATAGCAGGAACAAGG + Intronic
956631487 3:71320990-71321012 CAAAGGAAATAGAATGAGCAAGG + Intronic
956856376 3:73279035-73279057 CAAAGGAAACAGGATGAGAATGG - Intergenic
957137418 3:76307164-76307186 CTGAGGAAATAGCATGAGCATGG - Intronic
957678647 3:83403906-83403928 CTAAGGAGAAGGCAGGAGCCCGG + Intergenic
958192730 3:90204212-90204234 CTGAGGAAGCTGCAGGACCAGGG - Intergenic
958416148 3:93876142-93876164 CTGAGGAAGCTGCAGGACCAGGG - Intronic
958710540 3:97711539-97711561 CTAAGAAAAGGGCAGGGGCAGGG + Intronic
959274227 3:104257355-104257377 CAGAAGAACCAGCAGGAGCAAGG + Intergenic
959334195 3:105043345-105043367 CTAAGGAAACAGAACCAGAAAGG + Intergenic
959645212 3:108691690-108691712 TTGAGAAAACAGCAGAAGCAGGG - Intronic
959844060 3:111012767-111012789 GCAGGGAAGCAGCAGGAGCAGGG - Intergenic
960417704 3:117405486-117405508 CTGAGGAGGCAGCAGGGGCATGG + Intergenic
960680526 3:120243010-120243032 CTAAGGAGAGGGCTGGAGCAGGG + Intronic
961279001 3:125750521-125750543 ATAAGGATACAGCATGGGCAGGG - Intergenic
961280372 3:125761932-125761954 AGAAGGTAACAGCAGAAGCAAGG - Intergenic
961477526 3:127158006-127158028 CTGAGGCAACAGCAGGTGAAAGG + Intergenic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
964495600 3:157286594-157286616 TCAGTGAAACAGCAGGAGCATGG - Exonic
964903599 3:161691492-161691514 CTAGGGAAACAGCAAAAGCAAGG - Intergenic
965695075 3:171400018-171400040 CACAGGACACAGCAGGAGTAAGG + Intronic
966209630 3:177439762-177439784 CTCAGTAAAAAGCAGTAGCAAGG - Intergenic
967653242 3:192012778-192012800 CTGAGAAAACAAAAGGAGCAAGG - Intergenic
968402182 4:307335-307357 TGAAGGAAACAGCAAAAGCAGGG + Intergenic
968403237 4:316720-316742 CAAAAGGAACAGCAGGTGCAGGG + Intergenic
968516638 4:1018309-1018331 CTAGGGAAGGAGGAGGAGCAGGG - Intronic
969405009 4:6985769-6985791 ATAAGGCAAAAGCAGGAGTAGGG - Intronic
969543279 4:7807423-7807445 CAGAGGAAACAGCTGTAGCACGG - Intronic
969677327 4:8621314-8621336 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
969678282 4:8626952-8626974 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
969679238 4:8632590-8632612 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
969912942 4:10461754-10461776 CTTGGGACATAGCAGGAGCATGG + Intergenic
970536781 4:17038139-17038161 CTGAGGAAAGAGAATGAGCATGG - Intergenic
972842045 4:42942783-42942805 ATAAGGAAATAGAAAGAGCAAGG - Intronic
973770984 4:54206169-54206191 CTTAGCAAACAGCAGGCACATGG + Intronic
976343179 4:83967307-83967329 CTGATGAAGCAGCAGGAGAAGGG - Intergenic
976455043 4:85236670-85236692 CCTAGGAAACAGAAGCAGCAAGG - Intergenic
977141167 4:93374315-93374337 GTGAGGAAACAGCAATAGCAGGG + Intronic
978068472 4:104436101-104436123 CTAAGCTAAGAGCTGGAGCATGG - Intergenic
978584283 4:110261040-110261062 CTAAGGAGGCAGGAGGGGCAGGG + Intergenic
978649152 4:110979602-110979624 GAAAGGAAACATCAGGAGAATGG + Intergenic
980967730 4:139539369-139539391 CTAAGCAAAGAGCAGCAACAAGG + Intronic
982243815 4:153328649-153328671 CTGGGGAAACAGCAGGATCCAGG + Exonic
983714578 4:170764227-170764249 CTAAGGATACAGAAGAAGCAAGG + Intergenic
983732456 4:171012341-171012363 ACATGGAAAAAGCAGGAGCAAGG + Intergenic
983905817 4:173181714-173181736 CTAAGCAAACAGCAGGACCTGGG - Intronic
985145056 4:186887920-186887942 CTTAGGAAGCAGCATGAGAAGGG + Intergenic
985468496 5:20869-20891 CAAAGGAAAGAGCAGGATCCTGG + Intergenic
988109958 5:26807502-26807524 CTTTGGAACCTGCAGGAGCAAGG - Intergenic
988496083 5:31747465-31747487 CTGAAAAAACAGCAGAAGCAGGG - Intronic
988846730 5:35135208-35135230 CTAAGGAAAAGGCATGAGGAAGG + Intronic
989034521 5:37156089-37156111 CTCAGGAGACATGAGGAGCAAGG - Intronic
992181822 5:74205022-74205044 GTAAGGAAACAGAGAGAGCAGGG - Intergenic
994941116 5:106325468-106325490 CAAAGGAACCAGCAGCAGCTGGG + Intergenic
994997636 5:107084199-107084221 CCAAGACAACAGCAGGAACATGG + Intergenic
995502724 5:112825492-112825514 CAAAGGAAACAGCATGTGAAAGG - Intronic
996386715 5:122916535-122916557 GTAAGGAAGCATCAGGATCAAGG - Intronic
996912750 5:128674166-128674188 ATAAAGAAACAGCAGGAGGCGGG - Intronic
997681115 5:135751384-135751406 CTAAGGAACCACAGGGAGCAGGG - Intergenic
999304243 5:150509464-150509486 CTAAGGAAGAGGCAGGAGCGAGG - Intronic
999490590 5:152046585-152046607 CTGAGGAAACAGCCAGGGCAAGG - Intergenic
999971572 5:156869023-156869045 CTATTGAAACAACAGGACCAAGG - Intergenic
1001204529 5:169749867-169749889 CTAAGGGGATAACAGGAGCAGGG + Intronic
1001301757 5:170538616-170538638 CCAAGGACACAGCTGGTGCAAGG - Intronic
1001644719 5:173271518-173271540 CTAACGAAATGGCAGCAGCAAGG + Intergenic
1001774595 5:174319769-174319791 CTCAGGAGACAGCATGATCAAGG + Intergenic
1001969972 5:175947651-175947673 CTGAGGGAACAACAGGAGCAGGG - Intronic
1001979972 5:176031322-176031344 CCAAGGAAACAGTCAGAGCAGGG + Intronic
1002237410 5:177812341-177812363 CCAAGGAAACAGTCAGAGCAGGG - Intergenic
1002247465 5:177896113-177896135 CTGAGGGAACAACAGGAGCAGGG + Intergenic
1002901864 6:1416476-1416498 CCAAGGCAACCCCAGGAGCAGGG + Intergenic
1002905903 6:1449070-1449092 CAAAGGAGACAGCAGAAGGATGG - Intergenic
1003260637 6:4512429-4512451 CTGAGGAGACTGCAGGAGCCAGG + Intergenic
1003400300 6:5785150-5785172 CAGAGGATACAGCAGGAGAAGGG + Intergenic
1004144902 6:13056740-13056762 AAAAGGAAACATCAGGAGTAAGG + Intronic
1004290825 6:14365355-14365377 TTGAGGAAACTGCAGAAGCAAGG - Intergenic
1004398393 6:15266491-15266513 ATAAGGAAACAGCAGTTTCATGG + Intronic
1005188972 6:23196370-23196392 ACAAGGCAAAAGCAGGAGCAAGG - Intergenic
1005714028 6:28529983-28530005 CTCAGGAAAAAGCAGAGGCAGGG - Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006458960 6:34146918-34146940 TTCAGGAAAGGGCAGGAGCATGG - Intronic
1006728589 6:36218116-36218138 CTCAGGAAATAGCAGGAGTGGGG - Intronic
1008124751 6:47655650-47655672 CTAAGGAAACAAAATGAGGAAGG + Intergenic
1008165514 6:48133394-48133416 CTAAGAAAACCACAGGGGCATGG + Intergenic
1008225446 6:48909470-48909492 CTAAAAAGACAACAGGAGCAGGG - Intergenic
1009288336 6:61851583-61851605 CTAAGGACACAGCAGGAAGATGG + Intronic
1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG + Intergenic
1010754207 6:79648390-79648412 CAAAGGAAATAGCATGAGAAAGG - Intronic
1010987157 6:82438016-82438038 CTAAGGAAACAGGAGCAGTCAGG + Intergenic
1010989918 6:82469150-82469172 CTAATGAAACACCAGGAGTTTGG - Intergenic
1011641172 6:89417767-89417789 GTAATGAAAGAGCAGGAGGATGG + Intergenic
1013898783 6:115126358-115126380 CTAAGGAAAAAAAAGGAGAAAGG - Intergenic
1014472623 6:121835100-121835122 CAGAGAAAACAGCAGGAACAAGG - Intergenic
1014816659 6:125943164-125943186 CTAAGATAACGGCAGGAGCTTGG + Intergenic
1015392005 6:132693180-132693202 CCAAGGTAACAGCAGGATCATGG + Exonic
1015879711 6:137859205-137859227 CAAAGTAAACAGCTGTAGCAAGG + Intergenic
1016256242 6:142109113-142109135 CTATGAAAACAGCTGAAGCAGGG - Intergenic
1016389336 6:143559372-143559394 CTGAGGAAATATCAGGAGAAAGG + Intronic
1017600010 6:156070036-156070058 CAAAGAGAACAGCAGGAGCGAGG - Intergenic
1018223578 6:161606265-161606287 CTAAACACACAGCAGGAGGAAGG + Intronic
1018554038 6:165032647-165032669 CTGGGGAAACATCAGGGGCAAGG - Intergenic
1019265175 7:111115-111137 CGAAAGAAACAGAAGGAGCATGG - Intergenic
1019315496 7:382436-382458 CTGAGGACACAGCAGTAGAATGG + Intergenic
1019457324 7:1137207-1137229 TCGAGGAAACAGCAGGTGCAGGG - Intronic
1019471332 7:1223040-1223062 CTAAGGATTCAGAAAGAGCAGGG - Intergenic
1020094453 7:5360883-5360905 CTGAGGAAGCAGAAGGAGCGTGG - Intronic
1020411082 7:7892295-7892317 CTAAGGAAGAAGGTGGAGCAAGG + Intronic
1022027897 7:26465914-26465936 CTAAAGGAACAGAAGGAGCAAGG + Intergenic
1022131794 7:27411451-27411473 ATAAGGAACCAGGAAGAGCAAGG - Intergenic
1022793638 7:33714499-33714521 GAAAAGGAACAGCAGGAGCAGGG - Intergenic
1023895646 7:44430933-44430955 CTGAGGACACGGCAGGAGGATGG - Intronic
1024118322 7:46213353-46213375 CTCAGGAAGCAGAAGGAGCAGGG + Intergenic
1024163599 7:46706714-46706736 TTAAGGAAACAGAATAAGCAGGG + Intronic
1024448388 7:49509441-49509463 CTATGGAAACAGCTGTTGCAGGG - Intergenic
1025232524 7:57212005-57212027 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1026999689 7:74643724-74643746 CAAAGGCCACAGCAGGCGCAAGG + Intergenic
1027177293 7:75912748-75912770 CTAAGGAAACATCAGGAAACAGG - Intronic
1027654886 7:80918651-80918673 CTAAAGAAACAACTCGAGCAGGG + Intronic
1030354647 7:108528450-108528472 CTAAGCCAACAGCATGACCAAGG - Intronic
1030683720 7:112460600-112460622 CTAAGCAAGCAGCAGAAGCAAGG - Intronic
1030892180 7:115012558-115012580 CTAAGTAACCAGCAGTAGGATGG - Intronic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031329290 7:120443997-120444019 CTAAGGAAACAGCAGGAGCAAGG - Intronic
1031401406 7:121329345-121329367 GTAGGGGAACAGCACGAGCAGGG - Exonic
1031780785 7:125961461-125961483 CTGATGGAACAGCAGGAGGAGGG - Intergenic
1032189946 7:129759156-129759178 AAAAGGAAACACCAGGAGCCCGG - Intergenic
1032483810 7:132267854-132267876 CTAAGAAGTAAGCAGGAGCAAGG - Intronic
1032688062 7:134256102-134256124 CTACTGAAAAGGCAGGAGCAGGG - Intronic
1034801064 7:154057020-154057042 CTATGGATATTGCAGGAGCATGG + Intronic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1036434323 8:8719363-8719385 CTAAGAATAGAGCAGGAGCCAGG + Intergenic
1037491604 8:19401694-19401716 CTTAGGAAACATCAGGCACACGG - Intergenic
1037762497 8:21751160-21751182 CTTAGGAAGCAGCTGGTGCAGGG + Intronic
1038526992 8:28283291-28283313 GTGAGGAAACAGCAGAAGAATGG + Intergenic
1039119499 8:34130019-34130041 GTAAGGAACCAGCAGGAGCAAGG + Intergenic
1039382932 8:37102809-37102831 TGGAGGAAACAGGAGGAGCATGG - Intergenic
1039418600 8:37417357-37417379 CAAAGGAAAGATCAGGAGCTTGG - Intergenic
1039600038 8:38828737-38828759 TTGAGGACACAGCAGAAGCAGGG - Intronic
1040505654 8:48045586-48045608 TTAAGAAAACAGCAGAAGCAAGG - Intronic
1040696968 8:50011654-50011676 CAAAGGAAACAGAAGGAACCAGG - Intronic
1040973263 8:53160832-53160854 CTCAGGAAACAGCATGGGAAAGG - Intergenic
1042804659 8:72758154-72758176 GTAAGGAGACTGCAGGAGAAAGG + Intronic
1043735155 8:83731522-83731544 CCACGGAGCCAGCAGGAGCAAGG - Intergenic
1045544764 8:103118651-103118673 GCCAGGAAACAGCACGAGCAAGG + Intergenic
1046050436 8:109015196-109015218 CAAAAGAAACAGTAAGAGCATGG + Intergenic
1046285768 8:112091826-112091848 CTCAGGCAACAGCTGCAGCAAGG + Intergenic
1046541692 8:115591710-115591732 CAAAGGAAACAGAAAGTGCAGGG + Intronic
1047291534 8:123535226-123535248 CTAAAGAAGCAGCAGCAGCTTGG - Intronic
1047531081 8:125676013-125676035 CTAAGGAAACAGCAGGAGAATGG + Intergenic
1047635468 8:126756868-126756890 CAGAGGAAACAGCACGTGCAGGG - Intergenic
1048115233 8:131514232-131514254 CTATGGCAAAAGCAGGAGCAAGG - Intergenic
1048654192 8:136517232-136517254 CTGAGGAAACAGCATGAGTCTGG - Intergenic
1048949239 8:139480478-139480500 CTGAGGAGACGGGAGGAGCAGGG + Intergenic
1049021914 8:139962900-139962922 CTCAGGAAGCCGGAGGAGCAAGG + Intronic
1049186902 8:141260022-141260044 CTCATGAAACAGCATGAGCATGG + Intronic
1049274355 8:141712230-141712252 CTCAGGAAACAACATGAGGACGG - Intergenic
1049574082 8:143382475-143382497 CTAAGGAGCCAGAGGGAGCATGG + Exonic
1050633020 9:7580696-7580718 CTGAGAAAAAAGCAGGAGCTGGG + Intergenic
1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG + Intergenic
1051680051 9:19597939-19597961 CTATGTAAACAGCAGGAGGCAGG + Intronic
1052998685 9:34565464-34565486 CTCAGGCAGCAGCAGGAGAAGGG + Intronic
1054740723 9:68803543-68803565 CTTGGGAGACAGCATGAGCAGGG - Intronic
1056884698 9:90429966-90429988 CTAAGGAAACAGGGGAAGAAAGG + Intergenic
1057862940 9:98656319-98656341 CTAAAGAAAATGCAGGACCATGG + Intronic
1058410087 9:104722195-104722217 CTCTGGAATCAGCAAGAGCAGGG - Intergenic
1059665447 9:116442297-116442319 CTAAGGGAACAGGAGGAACATGG - Intronic
1059780074 9:117516851-117516873 GCAAGGAGACAGGAGGAGCAAGG - Intergenic
1059950291 9:119455171-119455193 CTAAGGAAAGATGAGGTGCAGGG - Intergenic
1060089519 9:120730814-120730836 CTAAGCAAACAGCAGGTGGGCGG + Intergenic
1060605255 9:124908347-124908369 CTTAGGAAACACCAGGAGTAAGG + Intronic
1061618463 9:131795206-131795228 CTGAGGAAATAGCAGGTGCAAGG - Intergenic
1062075887 9:134589816-134589838 CTGAGGAGACAGCAGGAGGTGGG - Intergenic
1062410586 9:136422178-136422200 CCAAGGAGGCAGCAGGTGCATGG - Intronic
1062453752 9:136626394-136626416 CAAAGCAGACAGCAGGTGCATGG + Intergenic
1062664030 9:137657206-137657228 TTGAGGAAGCAGCAGGAGCAAGG + Intronic
1062717990 9:138020782-138020804 CCCAGGAAACACCTGGAGCAGGG - Intronic
1062731053 9:138109463-138109485 TTGAGGACACAGCAGGACCATGG - Intronic
1186092091 X:6060858-6060880 CTGAGGATATAGCAAGAGCAAGG - Intronic
1186246439 X:7621092-7621114 CTGAGAAAATAGCAGAAGCAAGG - Intergenic
1186907438 X:14126871-14126893 TGGAGGAAACAACAGGAGCATGG - Intergenic
1188022346 X:25172616-25172638 CAAAGGACACAGCAGAAACAAGG - Intergenic
1189206402 X:39243035-39243057 CTCAGGAAACACCAAGAGAAGGG - Intergenic
1190446242 X:50527354-50527376 CAAGTGAAACAGCAGGAGCTAGG - Intergenic
1192268777 X:69558947-69558969 CCGAGGAAACAGCATGTGCAAGG + Intergenic
1192348512 X:70333843-70333865 CTAATGTAACAGAAAGAGCATGG + Intronic
1193524067 X:82566905-82566927 CCACGGAACCAGCAGGAGCCAGG + Intergenic
1194412958 X:93578502-93578524 CCAAAGAACCAGCAGGAGCTAGG + Intergenic
1194668698 X:96704426-96704448 CCAAGGCAACATCAGTAGCAAGG - Intronic
1196558436 X:117119482-117119504 CTAAAGAAACACTAGAAGCATGG + Intergenic
1196847210 X:119905684-119905706 CAGAGGGAACAGCAAGAGCAAGG - Intronic
1197711872 X:129677574-129677596 CTAAGGAAACAGGAGGAAGAAGG + Intergenic
1198768171 X:140099483-140099505 CTTAGCAAACAGCATGAACAAGG + Intergenic
1198941038 X:141955468-141955490 ATAAGGAAGCAGCAGAAGTAAGG + Intergenic
1199581833 X:149368303-149368325 CAAAGACAACAGCAGGACCAGGG + Intergenic
1199947806 X:152681844-152681866 CTGCGGAAACAGCAGGGGCAAGG - Intergenic
1199950075 X:152699860-152699882 CTGAGGTAACAGCAGGAGCAGGG - Intronic
1199954984 X:152735325-152735347 CTGAGGGAATAGCAGGGGCAGGG - Intronic
1199959599 X:152768601-152768623 CTGAGGTAACAGCAGGAGCAGGG + Intronic
1199961873 X:152786610-152786632 CTGCGGAAACAGCAGGGGCAAGG + Intergenic
1201963203 Y:19705351-19705373 GTTAGGAAACAACAGTAGCATGG - Intronic
1202371177 Y:24197080-24197102 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1202376150 Y:24239389-24239411 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1202494630 Y:25430729-25430751 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1202499607 Y:25473037-25473059 CAATGGAAAGAGCAGGAGAAGGG + Intergenic