ID: 1031335615

View in Genome Browser
Species Human (GRCh38)
Location 7:120527398-120527420
Sequence GATGTAGTGTACCGAAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 36}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031335615_1031335618 23 Left 1031335615 7:120527398-120527420 CCTGACTTTCGGTACACTACATC 0: 1
1: 0
2: 1
3: 1
4: 36
Right 1031335618 7:120527444-120527466 ATTAGCCCTTTGTATGGAACTGG No data
1031335615_1031335617 17 Left 1031335615 7:120527398-120527420 CCTGACTTTCGGTACACTACATC 0: 1
1: 0
2: 1
3: 1
4: 36
Right 1031335617 7:120527438-120527460 GTATACATTAGCCCTTTGTATGG No data
1031335615_1031335619 24 Left 1031335615 7:120527398-120527420 CCTGACTTTCGGTACACTACATC 0: 1
1: 0
2: 1
3: 1
4: 36
Right 1031335619 7:120527445-120527467 TTAGCCCTTTGTATGGAACTGGG 0: 1
1: 0
2: 2
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031335615 Original CRISPR GATGTAGTGTACCGAAAGTC AGG (reversed) Intronic
908030524 1:59994469-59994491 GATGTAGTATATGTAAAGTCCGG + Intronic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1068095886 10:52490730-52490752 CATGTATTGTACCTAAAGACAGG - Intergenic
1071444174 10:85730610-85730632 AATGAAGTGTACTGAAAGTTGGG + Intronic
1079871651 11:25805654-25805676 GAGGTAGAGAACAGAAAGTCCGG - Intergenic
1085905343 11:80753948-80753970 GATGTAATGTACCTAAAGTCTGG - Intergenic
1094557952 12:31521771-31521793 GATGAAGTGTACCTAAACTAAGG - Intronic
1102516991 12:113456295-113456317 GATGTTGTGTACCTAATGTGAGG + Intergenic
1110717961 13:78729657-78729679 GATTTGGTGTAGGGAAAGTCTGG - Intergenic
1113094354 13:106648108-106648130 GATGTAGAAGACTGAAAGTCAGG - Intergenic
1126377771 15:48013203-48013225 TATCTAGAGTACCGAGAGTCAGG - Intergenic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1164093941 19:21987974-21987996 CCTGTAGGGTACAGAAAGTCCGG - Intronic
928093654 2:28391522-28391544 GAAGTACTGTAGCGGAAGTCAGG - Intergenic
928248517 2:29653370-29653392 GATGTGATGTACCTAAAGACAGG - Intronic
946478164 2:220028918-220028940 GATGTGGAGATCCGAAAGTCTGG + Intergenic
1178548796 21:33517345-33517367 GAGGGAGTTTACCTAAAGTCTGG + Exonic
1183904733 22:41031948-41031970 GATGGAGAGTACTGAAAATCTGG - Intergenic
949416342 3:3818893-3818915 GAAGTAGGGTAAGGAAAGTCAGG + Intronic
968980130 4:3843125-3843147 GATGCTGTCTACCTAAAGTCAGG - Intergenic
974756060 4:66209681-66209703 GGTGTAGTGTGCTGAAAGTATGG - Intergenic
978190835 4:105909557-105909579 AAAGTAGTGTACTGAAAGTTAGG + Intronic
982823991 4:159979003-159979025 TATGTAGTGGCCTGAAAGTCTGG + Intergenic
992939013 5:81743404-81743426 GATGTAGTGTAGAGAATGACTGG - Intronic
1002112903 5:176932069-176932091 CATGCAGTGTAACGTAAGTCTGG + Intronic
1007789900 6:44302920-44302942 GAAGGAGTGAACAGAAAGTCGGG + Intronic
1013809656 6:114030139-114030161 GATGTAGTGTCTTGAATGTCAGG - Intergenic
1023194633 7:37621675-37621697 AATGTAGTGTCCTGAAAGCCAGG - Intergenic
1031335615 7:120527398-120527420 GATGTAGTGTACCGAAAGTCAGG - Intronic
1036084443 8:5598596-5598618 GATGAGGTGTTCAGAAAGTCAGG + Intergenic
1039651307 8:39341851-39341873 GAAGAAGTGTAGAGAAAGTCTGG - Intergenic
1043543813 8:81293079-81293101 CATGTAGTGTTCTGAATGTCTGG + Intergenic
1043773892 8:84240377-84240399 GATCTAGAATATCGAAAGTCTGG + Intronic
1043816073 8:84803068-84803090 GATGTAGTGTATAGAAAATGGGG + Intronic
1052456609 9:28707303-28707325 GATGCAAAGTACCTAAAGTCAGG + Intergenic
1057070434 9:92094400-92094422 AATGTAGTGTAACAAAAATCTGG - Intronic
1188056977 X:25552838-25552860 AATGGAGTGTACAGAAAGTTAGG + Intergenic
1201346831 Y:12993896-12993918 CATGTAGGGTACCCAAAGTCTGG + Intergenic