ID: 1031336118

View in Genome Browser
Species Human (GRCh38)
Location 7:120534596-120534618
Sequence ACTGAAAAAACACCCTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031336118 Original CRISPR ACTGAAAAAACACCCTTGGT GGG (reversed) Intronic
905111786 1:35600363-35600385 ACTGAGAAACCAACATTGGTTGG - Intronic
909543698 1:76819537-76819559 AAGGAATACACACCCTTGGTTGG - Intergenic
914440234 1:147699184-147699206 ACTGAAATAACACCATTGTGTGG - Intergenic
917068719 1:171125850-171125872 ACTGAAGCAAGTCCCTTGGTGGG - Intergenic
917976649 1:180244275-180244297 ACTTAAAGGGCACCCTTGGTAGG + Intronic
918100585 1:181369757-181369779 AGGGGAGAAACACCCTTGGTAGG + Intergenic
918223945 1:182461836-182461858 ACTGAACAGAGACCCTTGATGGG + Intronic
918564531 1:185912738-185912760 GCTTAAAACACACCCTTTGTGGG + Intronic
919509594 1:198445376-198445398 ACTTAGAAAACACACTTTGTTGG + Intergenic
922490545 1:226013227-226013249 ACTTAAAAACCAGCCTTGGCTGG + Intergenic
922605154 1:226885554-226885576 ACTGAGGACACACCCTCGGTGGG + Exonic
922773690 1:228205243-228205265 GATGAGAAAACACCCTTGTTTGG + Intronic
922888512 1:229040898-229040920 ACTGCAAATACACTGTTGGTAGG + Intergenic
923695864 1:236250536-236250558 ACTGAAAAAACAACCCTCTTGGG + Intronic
1068308153 10:55242178-55242200 ACTGAAGCAACACCAGTGGTTGG - Intronic
1070263697 10:74881999-74882021 ACCTAGAAAGCACCCTTGGTGGG + Intronic
1071441091 10:85695936-85695958 GATGAATAAACACCCTTGGGAGG - Intronic
1072659369 10:97353981-97354003 ACAGAAAAAACACCCTTCTTGGG + Intergenic
1078622242 11:12919430-12919452 ACTGACAAAACCTCCTTTGTTGG + Intronic
1079946050 11:26742088-26742110 AAAGAAAAAAAACCCATGGTTGG + Intergenic
1083057902 11:59840719-59840741 ACTGAAAAAGAACACTTGGCTGG + Intronic
1085140702 11:74138719-74138741 CCTGAAAGAAGATCCTTGGTAGG + Exonic
1087290970 11:96320117-96320139 ACTCATAAAACGCCTTTGGTGGG - Intronic
1089140346 11:116279250-116279272 ACTGGAAAAACAGCCTTGGCAGG + Intergenic
1092010909 12:5111832-5111854 CCTGAAAACAAACCCTTCGTGGG - Intergenic
1092023823 12:5224120-5224142 CCTGAAATCACACCCTTGCTTGG + Intergenic
1092053456 12:5489958-5489980 ACTGAGAAAACACCATATGTGGG + Intronic
1092978501 12:13769520-13769542 ACTGAATAAACACCAGTGGCTGG - Intronic
1094488058 12:30940577-30940599 ACTTAAAAAACATCCCAGGTTGG - Intronic
1095563334 12:43591070-43591092 TCTTAAATAACACCCTTTGTGGG + Intergenic
1096053339 12:48630274-48630296 ACAGAAAAACCATCCTTGGAAGG - Intergenic
1096479608 12:51929954-51929976 ACTTAAAGAAGACCCTTGGCCGG + Intergenic
1098805891 12:75020002-75020024 ATGGAATAAAAACCCTTGGTTGG + Intergenic
1101297701 12:103441477-103441499 AGTGGAAAAATACCCATGGTGGG - Intronic
1101300422 12:103474065-103474087 ACTGAAAAACCACCATGGGATGG - Intronic
1101310570 12:103575125-103575147 ACTGAAAACTCTCCCTTGGAAGG + Intergenic
1101384367 12:104243154-104243176 ATTGAAATAAAACCCTAGGTAGG - Intronic
1102065111 12:109968583-109968605 ACTGAAAAAACAAAATTAGTTGG - Intronic
1102801238 12:115736300-115736322 ACTTATAAACCACCCTTGCTTGG + Intergenic
1108069875 13:46617421-46617443 ACTTAAAAAACACTGTTGGAAGG - Intronic
1110422874 13:75333401-75333423 TTTAAAAAAACACCCTGGGTGGG + Intronic
1111442437 13:88297618-88297640 AAAAAAAAAAAACCCTTGGTTGG + Intergenic
1112895262 13:104291999-104292021 ACTCAAAACACTCCCTTGGGTGG - Intergenic
1113661790 13:112112696-112112718 ACTGAAAGGACACCTGTGGTGGG - Intergenic
1118379467 14:65205801-65205823 ACTTAAAAAACATCCATGGCTGG + Intergenic
1126230956 15:46323825-46323847 ACTGAATAAACCACTTTGGTAGG + Intergenic
1127769211 15:62217127-62217149 AGTGAACAAACATCCTTGTTTGG + Intergenic
1128408638 15:67370057-67370079 TCTGAAAGAACAGCCTTGGGTGG - Intronic
1130689308 15:86066718-86066740 ACGGATAAAACAGCCTGGGTGGG + Intergenic
1130921564 15:88350147-88350169 GCTGAGAAAACTCCCGTGGTTGG + Intergenic
1133582458 16:7159241-7159263 ACTGAAAAAAGATTCTTGGGTGG - Intronic
1135646957 16:24171535-24171557 ACTGAAAAATCACTGTGGGTGGG + Intronic
1135794970 16:25432942-25432964 AGGGAAACAACACCCTTTGTGGG + Intergenic
1135848504 16:25940904-25940926 ACAGAAAGAAAACCATTGGTTGG - Intronic
1137532779 16:49292280-49292302 ACTGGAAAAACACCATTAGGAGG + Intergenic
1138244874 16:55460055-55460077 GCTGAAAAAACGGCCTTGTTTGG + Intronic
1141168524 16:81676674-81676696 ATTTATTAAACACCCTTGGTGGG + Intronic
1142933030 17:3304101-3304123 ACTGAGACAACACTCTTTGTAGG + Intergenic
1146574417 17:33978887-33978909 ACAGAATAAACACACTTGGGGGG + Intronic
1148102641 17:45102015-45102037 ACTGAAAACACAGCCATGCTGGG - Intronic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1149253235 17:54794398-54794420 ACTGTAACCTCACCCTTGGTGGG - Intergenic
1150868866 17:68882177-68882199 CCTGAAAAAACTGCCTTTGTAGG - Intronic
1152293274 17:79452838-79452860 AGGGAAGAAACACCCTTGGCAGG + Intronic
1155354904 18:24942519-24942541 ACTGGAAAAACATCCAAGGTTGG - Intergenic
1155498602 18:26465703-26465725 TCTGAAACAACACCCTGGCTTGG + Intronic
1157021290 18:43785446-43785468 ACTGTAAAAGCACACTTTGTTGG - Intergenic
1157094806 18:44678716-44678738 CCTGAAAAGACCCCCTTTGTAGG + Intergenic
1159363133 18:67430945-67430967 TCTGTGAAAACACTCTTGGTGGG - Intergenic
1161932958 19:7353194-7353216 AGTGAAAAACCACCCTTGCTTGG - Intronic
1164554527 19:29240986-29241008 ACAGAAAAAGGACCCTGGGTTGG - Intergenic
1164938247 19:32231340-32231362 ACTGAGAAGGCACCCTTGGTGGG - Intergenic
1165536206 19:36447828-36447850 ACTGAAGAAAGACCCTTTGAAGG - Exonic
1168029611 19:53669252-53669274 ACCGAAAAAACACCATGGGGGGG + Intergenic
925810850 2:7698965-7698987 CCTGAAAATTCACCCTTGGGAGG + Intergenic
926489000 2:13500494-13500516 AACAAAAAAACACCCTTGGGTGG + Intergenic
926655689 2:15403230-15403252 ACTGAGAAAATGCCCTTGTTTGG - Intronic
927039460 2:19213473-19213495 GCTGAAAAACCACCCCTGGCCGG - Intergenic
929023385 2:37575994-37576016 CCTGCAACAACACCCTTGTTTGG + Intergenic
929697543 2:44131938-44131960 ACTTAAAAATCACCTTTGGGCGG + Intergenic
932210540 2:69925218-69925240 CCTAAGAAAACACCCTTGGGAGG + Intronic
932747340 2:74344805-74344827 AAAGAAAAATCACCCTTGTTTGG + Intronic
934813285 2:97302935-97302957 ACTCACAAAGCACCATTGGTAGG + Intergenic
934824410 2:97405545-97405567 ACTCACAAAGCACCATTGGTAGG - Intergenic
935749518 2:106218967-106218989 GCTGAAAAAACACCATATGTTGG + Intergenic
938844482 2:135194852-135194874 AAAGCAAAAACACCCTTGGCAGG + Intronic
938953952 2:136281782-136281804 ACTGAAAAATCCCCTTTGGGGGG + Intergenic
939658110 2:144852844-144852866 ACTTAAAAAACAGCATTGGGAGG - Intergenic
940057404 2:149527154-149527176 ACAGAAAAACCACCCTTGAACGG - Intergenic
940531012 2:154875835-154875857 ACTGAAAAAATGCCCTTTGTTGG - Intergenic
944348860 2:198703272-198703294 ACTGCAAAATCACCTTTGGAGGG - Intergenic
945565763 2:211397657-211397679 ACTGCAAAATCAACCTTAGTGGG - Intronic
1170085851 20:12530911-12530933 CCTGAAACAACACCCTTGCTTGG - Intergenic
1170151942 20:13235641-13235663 ACTCAGAAACAACCCTTGGTGGG - Intronic
1170762921 20:19266682-19266704 ACTGAAGAAACACATTTGGCAGG + Intronic
1171052428 20:21872309-21872331 ACCAAAAGAACACCCTAGGTTGG + Intergenic
1171129254 20:22633971-22633993 CCTGAAACCACACCCTTGCTTGG - Intergenic
1172344131 20:34183792-34183814 AGTGAATAAACACCCTGGGCTGG + Intergenic
1172723231 20:37015367-37015389 ACAGAAAAACCACCCTGGATAGG + Intronic
1173068463 20:39737285-39737307 CCTGAAAAAACAGCCTTGCATGG - Intergenic
1175515491 20:59567348-59567370 ACTGCAGAAACACCCTGGGCTGG + Intergenic
1177784721 21:25658969-25658991 ACTGAAAATATACTATTGGTTGG - Intronic
1178936423 21:36866311-36866333 ACTGAAGATACACACTAGGTAGG + Intronic
1181511701 22:23392339-23392361 AAAGAAAAAAAACTCTTGGTGGG + Intergenic
950562920 3:13745994-13746016 TGTGAAAAAACACCCTTGAGAGG - Intergenic
953301415 3:41780433-41780455 ACTCTAAAAAGACCTTTGGTGGG - Intronic
954877602 3:53812673-53812695 ATGCAAAAAACACCCTGGGTGGG - Exonic
956543674 3:70374571-70374593 ACTGATAATACTGCCTTGGTTGG + Intergenic
956881352 3:73514063-73514085 AATGTAAAATTACCCTTGGTTGG + Intronic
957179867 3:76862569-76862591 TCTGAACACACAGCCTTGGTAGG - Intronic
957702746 3:83738847-83738869 AATGAAAAAATAGCTTTGGTGGG + Intergenic
958847052 3:99277937-99277959 ACAGAAAAAACACCCTCGTAAGG + Intergenic
962732628 3:138297799-138297821 ACTGTGAAAATATCCTTGGTTGG + Intronic
964080198 3:152745084-152745106 ACTAAGAAAAGACACTTGGTGGG + Intergenic
964948133 3:162250919-162250941 ACTGAAACACCATCCTTAGTGGG - Intergenic
967672893 3:192260370-192260392 ACTGAATAAACACTATTAGTTGG - Intronic
968718034 4:2176568-2176590 AATGAAGAAATACCCTCGGTTGG - Intronic
974068450 4:57102193-57102215 AGTGACAGAACACCCTTGGATGG - Intronic
978095549 4:104771611-104771633 ACTGACAAAACACACATAGTAGG + Intergenic
978383897 4:108160901-108160923 ACTGGAAAAACACCTGGGGTGGG - Intronic
982103304 4:151989767-151989789 ACTGAAAAAACTCCATTGAAAGG - Intergenic
985492344 5:187143-187165 AATGTAAAAACACTCTTGCTGGG - Exonic
986532936 5:8758291-8758313 TCTCAAAACACACCTTTGGTGGG + Intergenic
986811229 5:11361659-11361681 ACTGAGAAATCCCCTTTGGTGGG - Intronic
987167062 5:15210681-15210703 ACTGAATAAAAACCCTAAGTTGG + Intergenic
989856239 5:46296453-46296475 TCTGGAAAAACACTTTTGGTGGG - Intergenic
991360829 5:65818404-65818426 AAGGAAAAAACACACTGGGTAGG - Intronic
992422891 5:76624775-76624797 ACTGAAAAAGCAGACTTGGCTGG + Intronic
993384300 5:87245638-87245660 AATAAGAAAACACCCTGGGTTGG - Intergenic
994187306 5:96829377-96829399 AATCAAACAACACCCTTAGTAGG + Intronic
994438634 5:99771478-99771500 ACTGAAGAAACATTCTTGCTTGG - Intergenic
995046014 5:107648910-107648932 ACTGAAAAAACAAAGTTGGAGGG + Intronic
995698873 5:114910709-114910731 AATGAAAAAACACCTGTGATAGG + Intergenic
997709674 5:135993276-135993298 ACTGAAAACACCTCCTTAGTCGG - Intergenic
997826098 5:137108250-137108272 ACTGAAATAGCCCCCTTGGAAGG + Intronic
999666702 5:153920288-153920310 AATTAAAAAACAGCCTTGGCCGG - Intergenic
1001441156 5:171743973-171743995 ACTGAAGGAACTCCCTTGATGGG - Intergenic
1001636949 5:173217122-173217144 ACTGTAAAAAGATCCATGGTTGG - Intergenic
1003101462 6:3179460-3179482 ACTGGAAAAACACGCTTCATTGG - Intergenic
1003627252 6:7753296-7753318 AATGAAAAAACAGATTTGGTGGG + Intronic
1007805957 6:44446805-44446827 ACTGAAAAACCACAGATGGTGGG - Exonic
1008645293 6:53508062-53508084 CCTTTAAAAACACCCTTGTTCGG + Intronic
1011556262 6:88573869-88573891 AGTGAAACCACATCCTTGGTTGG + Intergenic
1012590844 6:100978584-100978606 ACAGAAAATACACGCTAGGTAGG - Intergenic
1012609217 6:101194778-101194800 ACTGCAAAAACACCTCAGGTAGG - Intergenic
1014968593 6:127787035-127787057 CCTGAAAAAGCACCCTTTCTAGG + Intronic
1018161339 6:161046035-161046057 ACTAAAAAAACACACATGTTGGG - Intronic
1020768815 7:12360864-12360886 ACTGAAAAAACAATGTAGGTAGG + Intronic
1021391269 7:20095696-20095718 AATGTAAAAACATCCTGGGTGGG - Intergenic
1021595596 7:22312995-22313017 ACTGAAAATACACTGTGGGTAGG - Intronic
1022831274 7:34069254-34069276 ACTTAAAAAATACACTTGGTGGG + Intronic
1023882660 7:44329340-44329362 ACTGACAAAATGCCCTTGCTGGG - Intronic
1028106416 7:86884462-86884484 ATTGAAAATACAGCATTGGTGGG + Intronic
1031336118 7:120534596-120534618 ACTGAAAAAACACCCTTGGTGGG - Intronic
1034593543 7:152165123-152165145 ACTGAGAAATTACCATTGGTTGG + Intronic
1035065291 7:156099985-156100007 ACTCAAAAAGCACCCTTGGAAGG - Intergenic
1038693059 8:29780712-29780734 ATTGAAAAGACACATTTGGTCGG - Intergenic
1039635725 8:39162705-39162727 AGTAAAAAAAAACCCTTGGTCGG + Intronic
1039805646 8:40995192-40995214 CCTGACATAACACCCCTGGTAGG + Intergenic
1042803221 8:72743684-72743706 ACAGAAAAAATACCATTGGTTGG - Intronic
1042959255 8:74285624-74285646 ACTGAATAATCACACTAGGTGGG - Intronic
1043276527 8:78402960-78402982 ACTGAAAAAAGAACCGTTGTTGG - Intergenic
1044575154 8:93760430-93760452 ACTGAGAAAACACCCAGGTTGGG + Intronic
1047036189 8:120941042-120941064 ACTGACAATGCAGCCTTGGTTGG + Intergenic
1047816551 8:128470374-128470396 AATGAAAAAACACCTATAGTAGG - Intergenic
1048498308 8:134954115-134954137 GCTGAAATCACACCCTTGCTTGG - Intergenic
1049597371 8:143491036-143491058 ACTGAAAAACCACCCCTGACAGG - Intronic
1050007772 9:1151894-1151916 ACTGTAAAATTACTCTTGGTTGG - Intergenic
1051294843 9:15584522-15584544 ACTGAACAAACAGGCTTGCTGGG - Intronic
1051416808 9:16850026-16850048 ACTAAAAAAACAGACTAGGTAGG + Intronic
1058713262 9:107699483-107699505 AATGAAAACACACCCTTGGTTGG + Intergenic
1060494324 9:124106795-124106817 TCTGAAACAACACCCTGGGGTGG + Intergenic
1186159267 X:6759616-6759638 AAGGCAAAATCACCCTTGGTTGG + Intergenic
1186361331 X:8845173-8845195 TCTGAAACTACACCCTTGCTTGG - Intergenic
1187007341 X:15245651-15245673 ACTGAAGCAACATCCCTGGTTGG - Intronic
1188041333 X:25372703-25372725 GCTGAAATTACACCCTTGTTTGG + Intergenic
1188188840 X:27148824-27148846 ACTAAAAAAATTCCCTTGCTGGG - Intergenic
1189220692 X:39369247-39369269 CTTGATAACACACCCTTGGTTGG - Intergenic
1190013921 X:46810130-46810152 ACTGAAATAACTCACTTGATGGG - Intergenic
1192556187 X:72091491-72091513 ACTGAAACAACTTCTTTGGTGGG - Intergenic
1192639416 X:72847894-72847916 AGTGAAGAAACACCCCTGGAGGG + Intronic
1192642295 X:72872911-72872933 AGTGAAGAAACACCCCTGGAGGG - Intronic
1193318428 X:80092148-80092170 AATGAAAAAACAGCCTGGGAGGG + Intergenic
1197334797 X:125200014-125200036 ACTGAACAGACACCTATGGTTGG + Intergenic
1198080706 X:133236624-133236646 ACAGAAAACACAACCTTGGATGG - Intergenic
1198482366 X:137052625-137052647 TCTTCACAAACACCCTTGGTGGG - Intergenic
1199132926 X:144215092-144215114 CCTGAAAACACACACTTGATTGG - Intergenic
1200253632 X:154567681-154567703 GCTGGAAAAACACCCCTGCTTGG + Intergenic
1200264135 X:154636727-154636749 GCTGGAAAAACACCCCTGCTTGG - Intergenic
1201549321 Y:15202951-15202973 ATTAAAAAAACTCCCTTGGCTGG - Intergenic
1202347618 Y:23950312-23950334 ACTGAATAAACAGCCCAGGTGGG - Intergenic
1202523154 Y:25719779-25719801 ACTGAATAAACAGCCCAGGTGGG + Intergenic