ID: 1031339596

View in Genome Browser
Species Human (GRCh38)
Location 7:120582597-120582619
Sequence ATGGAGAAAGAGGCAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2520
Summary {0: 1, 1: 0, 2: 20, 3: 265, 4: 2234}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031339596_1031339601 -3 Left 1031339596 7:120582597-120582619 CCCTCCTCTGCCTCTTTCTCCAT 0: 1
1: 0
2: 20
3: 265
4: 2234
Right 1031339601 7:120582617-120582639 CATCCTCCCATTCCATAAAGTGG No data
1031339596_1031339602 -2 Left 1031339596 7:120582597-120582619 CCCTCCTCTGCCTCTTTCTCCAT 0: 1
1: 0
2: 20
3: 265
4: 2234
Right 1031339602 7:120582618-120582640 ATCCTCCCATTCCATAAAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031339596 Original CRISPR ATGGAGAAAGAGGCAGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr