ID: 1031339596 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:120582597-120582619 |
| Sequence | ATGGAGAAAGAGGCAGAGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2520 | |||
| Summary | {0: 1, 1: 0, 2: 20, 3: 265, 4: 2234} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1031339596_1031339601 | -3 | Left | 1031339596 | 7:120582597-120582619 | CCCTCCTCTGCCTCTTTCTCCAT | 0: 1 1: 0 2: 20 3: 265 4: 2234 |
||
| Right | 1031339601 | 7:120582617-120582639 | CATCCTCCCATTCCATAAAGTGG | No data | ||||
| 1031339596_1031339602 | -2 | Left | 1031339596 | 7:120582597-120582619 | CCCTCCTCTGCCTCTTTCTCCAT | 0: 1 1: 0 2: 20 3: 265 4: 2234 |
||
| Right | 1031339602 | 7:120582618-120582640 | ATCCTCCCATTCCATAAAGTGGG | 0: 1 1: 0 2: 0 3: 9 4: 153 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1031339596 | Original CRISPR | ATGGAGAAAGAGGCAGAGGA GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||