ID: 1031340684

View in Genome Browser
Species Human (GRCh38)
Location 7:120596291-120596313
Sequence CTTTTTAAGCAGACATTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031340684_1031340687 15 Left 1031340684 7:120596291-120596313 CCAGCCAATGTCTGCTTAAAAAG 0: 1
1: 0
2: 5
3: 20
4: 173
Right 1031340687 7:120596329-120596351 GCATCTGCTCCAGAAATATGAGG No data
1031340684_1031340688 16 Left 1031340684 7:120596291-120596313 CCAGCCAATGTCTGCTTAAAAAG 0: 1
1: 0
2: 5
3: 20
4: 173
Right 1031340688 7:120596330-120596352 CATCTGCTCCAGAAATATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031340684 Original CRISPR CTTTTTAAGCAGACATTGGC TGG (reversed) Intronic
901653757 1:10757489-10757511 TTTTTAAAACAAACATTGGCTGG + Intronic
905060580 1:35136236-35136258 CTTTTTAAGAAGAAATTGCTGGG + Intergenic
913329238 1:117653543-117653565 TTTTTCAAGAAGACACTGGCGGG - Intergenic
914215217 1:145620155-145620177 CTATTTAAGCAGGGGTTGGCAGG + Intronic
915092578 1:153436875-153436897 CTCTGGAAGCAGACATTTGCTGG + Intergenic
916148060 1:161759309-161759331 CTTTTAAAACATAAATTGGCCGG + Intergenic
916765319 1:167854695-167854717 TTTTTAAAACAGACATTGGAAGG + Intronic
917431966 1:174979309-174979331 CCTTTGAAGCAGACACTGGTTGG + Intronic
917828201 1:178846809-178846831 TTTTTTAAGCAGGCTTTAGCAGG + Intronic
918253883 1:182730382-182730404 CTTTTCTAGCAGAGTTTGGCTGG + Intergenic
919213093 1:194513481-194513503 CATTTTGAGCAGTCATTGGATGG - Intergenic
922536364 1:226383947-226383969 CTTTTTAACCAGACTATGGTTGG - Intronic
1062874867 10:934918-934940 CTTTTTAAGGAAACATGTGCTGG - Intergenic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1065497341 10:26342618-26342640 CTTTTTAAGTGAACATTGGAGGG - Intergenic
1065587656 10:27235492-27235514 GTTTTTAAAGAGACATTTGCAGG - Intronic
1066986569 10:42473758-42473780 CTTGTTTATCTGACATTGGCTGG + Intergenic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1067005248 10:42654821-42654843 CATTTTAAGCAATCAGTGGCCGG - Intergenic
1071875108 10:89836762-89836784 CTCTTGAAGCAGACAGGGGCTGG - Intergenic
1072897991 10:99383570-99383592 TTTTTTAAGCACTAATTGGCTGG + Intronic
1077723038 11:4646421-4646443 CTTCTTAAGGAGACATGGGGAGG + Intronic
1080036888 11:27720090-27720112 CATTTGAATCAGACATTTGCAGG + Intronic
1084047109 11:66575399-66575421 CTTTTTAAGAAGAAATTGCTGGG - Intergenic
1084863566 11:72038582-72038604 AGCTTTAAGCAGACTTTGGCTGG + Intronic
1088783325 11:113157176-113157198 CTTTTTAAGCAGAACATGCCAGG - Intronic
1090107656 11:123869521-123869543 CTTTTTAAGAGGAAATTGCCGGG + Intergenic
1095925275 12:47572529-47572551 TTTTTTGAGCAGAAATTGACAGG - Intergenic
1096545489 12:52336120-52336142 CTTTTTAGGCTGGCTTTGGCAGG - Intergenic
1100039373 12:90295306-90295328 CTTTAGAAGCAGACAATGGAAGG - Intergenic
1101167031 12:102048972-102048994 CTTTTTAAAGAGCCATTGTCAGG + Intronic
1106595449 13:31131593-31131615 CTTTTTAAGTAGACATTGCCAGG - Intergenic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1110146887 13:72202854-72202876 CTTTTTCAGCAGAGATGGGGAGG - Intergenic
1110880477 13:80566192-80566214 CTTATTAAGAAATCATTGGCTGG - Intergenic
1111580179 13:90212191-90212213 CCTTTTAAGCACAGATTGGAAGG - Intergenic
1112490402 13:99857966-99857988 CTTTTGAAACTGAAATTGGCAGG + Intronic
1112688669 13:101863498-101863520 CTATTTACTCAGACATTGGCAGG - Intronic
1113436094 13:110292286-110292308 ATTTTTAAGAAGACAATGCCTGG - Intronic
1115097191 14:29650653-29650675 CCTTTTAAGCAGTTTTTGGCAGG + Intronic
1115967474 14:38907905-38907927 CTTTTTAAACTGACATTTACTGG - Intergenic
1117228994 14:53696098-53696120 CTTTTTAAGTATACATTTGCAGG + Intergenic
1117316561 14:54576833-54576855 CCCTTTAGGCAGACAGTGGCTGG - Intronic
1119883266 14:78118941-78118963 CTTTGAAACCAGGCATTGGCTGG + Intergenic
1120910790 14:89664992-89665014 CTGTTGAGGCAGAAATTGGCAGG + Intergenic
1123790319 15:23712954-23712976 CTTTTTAAGCAGCATTTGGGTGG + Intergenic
1124053138 15:26217630-26217652 CATTTTCAGCAGCTATTGGCTGG + Intergenic
1124452022 15:29802576-29802598 TTTTTTAAACAAACATTGACCGG + Intronic
1125556572 15:40590732-40590754 CGTTTTACGCAGTCAGTGGCCGG + Intergenic
1126280283 15:46939344-46939366 TTTTTTTAGCAGCCATGGGCAGG + Intergenic
1126588568 15:50315901-50315923 ATTTTTTAGCAGAGATGGGCGGG - Intronic
1126843694 15:52740404-52740426 CTTTTTAAGAAGAAATTGCTGGG - Intergenic
1128981674 15:72192750-72192772 ATTTTTAAGCAGTTTTTGGCTGG - Intronic
1130141567 15:81230434-81230456 CTCTTTCTTCAGACATTGGCAGG + Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131040896 15:89265832-89265854 TTTTTTAAGCAAACATTTGTAGG + Intronic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1131908724 15:97172533-97172555 CTTTTTAAAGAGACATTCCCAGG + Intergenic
1138548110 16:57731338-57731360 CTGTGTAAACAGGCATTGGCTGG - Exonic
1144999402 17:19293080-19293102 CTTTTTAAGATGGGATTGGCTGG + Intronic
1145080315 17:19889456-19889478 CTTTTTAAACAAACAGTTGCTGG - Intergenic
1146826104 17:36024368-36024390 CTCTTTAAGGAGACATTGTTTGG - Intergenic
1147014502 17:37480528-37480550 CTTTTTAATCAGACACTGGCTGG + Intergenic
1151122707 17:71810100-71810122 CTTTTGAAGCTGAATTTGGCTGG - Intergenic
1154370676 18:13759762-13759784 ATTTTTAGGCAGACATGGGATGG - Intronic
1157149990 18:45207152-45207174 CATTTTAAGTAGACAAGGGCAGG + Intergenic
1157906454 18:51573965-51573987 CTTTTTAAGAGGAAATTGCCGGG + Intergenic
1158768244 18:60482446-60482468 CTTTTAAAGCATACGTAGGCTGG + Intergenic
1158813445 18:61065500-61065522 CTTTTTAAACAGACATTGGGAGG + Intergenic
1159164411 18:64683448-64683470 CTTTTTAAGAAGAAATTGCTGGG - Intergenic
1159934013 18:74346681-74346703 TTTTTAAAACAGACATGGGCTGG - Intronic
1160508378 18:79439899-79439921 GTTTTTAAGCAGTGACTGGCTGG - Intronic
1160514563 18:79471274-79471296 CTTTCTAACCAGACCTGGGCAGG - Intronic
1160938306 19:1608294-1608316 CTTTTAAAATATACATTGGCCGG - Intergenic
1162663059 19:12185513-12185535 CTGTATGAGCAGACATTAGCTGG + Intronic
1164513406 19:28915111-28915133 CTCTTTAAGAAGAAAGTGGCAGG - Intergenic
1165579280 19:36848439-36848461 GTTTTTTAGGAGACATTGGTGGG + Intronic
1167589103 19:50393371-50393393 ATTTTAAAGCAAACAATGGCTGG + Intronic
925972821 2:9119005-9119027 TTAGTTAAGCAGACATTGCCTGG + Intergenic
926042519 2:9685247-9685269 CATTTTAAGAAGATACTGGCCGG + Intergenic
926370417 2:12173075-12173097 CTTTCCAAGCACACATAGGCAGG + Intergenic
926817940 2:16819151-16819173 CTTTATAAGCAGAGAAAGGCTGG - Intergenic
927744538 2:25605013-25605035 CATTTTAAACAGAACTTGGCTGG - Intronic
928770115 2:34695628-34695650 CTTTTTAAGAGGACATTGCTGGG - Intergenic
932537347 2:72613160-72613182 TTTATTAAGCAGGCATTTGCTGG + Intronic
932800154 2:74734547-74734569 TTTTTTTACCAGACTTTGGCTGG - Intergenic
933281641 2:80338320-80338342 CTTTTAAAGCAGATAATGGGAGG + Intronic
936443298 2:112574994-112575016 CATTTTAAGCAGATTGTGGCCGG + Exonic
937426613 2:121805119-121805141 CTTAGTAAACAGACATTAGCAGG - Intergenic
938117766 2:128613416-128613438 CTTCTCAAGCAGACATTCCCAGG - Intergenic
938142523 2:128808592-128808614 CTATTTAAGCACACAGTTGCTGG + Intergenic
941063523 2:160875300-160875322 CATTTTGAGCAGACATTGATGGG + Intergenic
942633878 2:177980599-177980621 TTTTTTATGAAGACATTGGTTGG + Intronic
943249047 2:185494200-185494222 CATTTTAAGCACTCATTTGCTGG - Intergenic
944399560 2:199309589-199309611 TTTTGGAAGCAGACATTTGCAGG - Intronic
944478823 2:200134384-200134406 GTTTTGGAGCAGACATTGGGTGG - Intergenic
945112936 2:206380698-206380720 CTTTTAAAGAAGACAATGGAAGG - Intergenic
946575389 2:221070582-221070604 CTGTCTAGGAAGACATTGGCTGG - Intergenic
948730649 2:239961704-239961726 CCTTTTAAGTAGACATGGGCAGG + Intronic
1176272591 20:64244015-64244037 ATTTTAAGGCATACATTGGCAGG - Intergenic
1176874548 21:14115381-14115403 CCTTTTAAGCTGTCAGTGGCCGG - Intronic
1177371629 21:20211422-20211444 CTTTATAAGCAGATATTGTAAGG - Intergenic
1178441204 21:32599831-32599853 CTTTTGAGGCAGACAAGGGCAGG + Intronic
1182159771 22:28109988-28110010 CTTATCCAGCAGACATTAGCTGG + Intronic
1182343893 22:29645777-29645799 CTGTTTAAGCAAACATCTGCTGG - Intronic
1183243977 22:36679318-36679340 CTTTATAAGAAAACATGGGCAGG + Intronic
951141296 3:19164704-19164726 CTTTTTAAGAAGACATTATCTGG + Intronic
951141370 3:19165671-19165693 CTTTTTAAGAAGACATTATCTGG - Intronic
951889501 3:27555274-27555296 CTTTTTGAGCACACATTGGTTGG - Intergenic
952191277 3:31025862-31025884 CATTTTAAGAAGCCATTGGAAGG - Intergenic
952597426 3:35035084-35035106 CTTTATAAGCTGGTATTGGCTGG - Intergenic
952620775 3:35338868-35338890 CCTTTTAAGCAGATATTAACAGG - Intergenic
954179241 3:48868597-48868619 CTTTTTCAGCTGACATATGCAGG - Intronic
956654142 3:71532859-71532881 GTTTTTAAGCATACATTTTCAGG + Intronic
964357388 3:155863111-155863133 GTTTTTAAGAACAAATTGGCTGG - Intergenic
965694364 3:171391994-171392016 CTTTTCTTGCAGACATTAGCAGG - Intronic
969152632 4:5183179-5183201 CTTTAAAACCAGGCATTGGCCGG + Intronic
970648985 4:18157072-18157094 TTTGTTCAGCAAACATTGGCTGG - Intergenic
970662160 4:18297644-18297666 TTTGTAAAGTAGACATTGGCTGG - Intergenic
971294168 4:25374692-25374714 CTTTTTAAGGAGGCAAGGGCAGG - Intergenic
973062842 4:45750561-45750583 TTTTTTAATCAGTCATTGGCTGG + Intergenic
975214269 4:71735912-71735934 CTTCTAAAGCAGTGATTGGCAGG + Intergenic
975246727 4:72128968-72128990 ATATTTCAGCAGCCATTGGCAGG + Intronic
976460428 4:85304646-85304668 CTATTTAAGCAGACATTTGCAGG - Intergenic
977665248 4:99639346-99639368 CGTTTTCAGGAGAGATTGGCTGG - Exonic
981648706 4:147030287-147030309 CTTTTGAATCAGACTTTGGCTGG - Intergenic
982867394 4:160532394-160532416 CTTTTGAAGGAGACATTTTCTGG + Intergenic
985329761 4:188818198-188818220 TTTTTTAAGTACAAATTGGCCGG - Intergenic
986098253 5:4581538-4581560 CTTGTTTAGCAGACAGAGGCAGG - Intergenic
986125583 5:4880272-4880294 CTTTTTGTGCTGACACTGGCGGG + Intergenic
986573187 5:9186390-9186412 CTTTTCAAACAGCCATTGGCTGG + Intronic
987004808 5:13699398-13699420 TTTTTTAAGCAAACATTTGCTGG - Intronic
988559056 5:32263906-32263928 CGTCTTATGCACACATTGGCAGG - Intronic
991948559 5:71925753-71925775 CTCTCTCACCAGACATTGGCAGG - Intergenic
992428125 5:76679562-76679584 CTCTTTAAGAAGACATTATCAGG + Intronic
992489259 5:77225635-77225657 CTTTTTAAGTGGACATAGCCAGG + Intronic
994541186 5:101100021-101100043 CTTTTTATGGACTCATTGGCAGG + Intergenic
994935066 5:106243791-106243813 CTTTTTAAGTAGACGTTGTTTGG + Intergenic
995481744 5:112599989-112600011 CTTTTTCAGCAGAGATTTGTGGG - Intergenic
1000438527 5:161241756-161241778 CTTTTTAAGAAGAAATTGCTGGG - Intergenic
1000439663 5:161250280-161250302 CTTTTTAAGCGGAAATTGCTGGG - Intergenic
1001585152 5:172828987-172829009 TGTTTTAAGCAGAGAATGGCTGG - Intergenic
1002945041 6:1752774-1752796 CTTTTGAAGCTTACTTTGGCTGG - Intronic
1003545680 6:7056422-7056444 CTTTTTGAGGAAACATTGCCGGG + Intergenic
1003562513 6:7194251-7194273 TTTTAAAAGCAGGCATTGGCCGG + Intronic
1006532014 6:34663638-34663660 CTTTTTAAAGAGACCTTAGCTGG - Intronic
1006576557 6:35050761-35050783 CTGTTTGGGCAGAGATTGGCAGG - Intronic
1007222361 6:40288936-40288958 CTTTATAAGGAGTCATTGGGGGG + Intergenic
1009727670 6:67556608-67556630 CTTTTGAAGCTTACTTTGGCTGG + Intergenic
1010563542 6:77381290-77381312 CTTTTTAAAAAGGCATAGGCGGG + Intergenic
1013438861 6:110140602-110140624 ATTCTTCAGCAGACACTGGCTGG - Intronic
1013892560 6:115043038-115043060 CTCTTTACCCTGACATTGGCTGG + Intergenic
1013961268 6:115903253-115903275 CTTTTGAAGCAGAAATTAGGTGG - Intergenic
1014039010 6:116802460-116802482 GTTTTTAAGCACACATGGCCAGG + Intronic
1015602893 6:134927825-134927847 GTTTTTCACCAGACATTTGCAGG + Intronic
1018818504 6:167354557-167354579 CTTTAGAAGCAGACAATGGAAGG - Intronic
1020074056 7:5246071-5246093 CCTTTAAAACATACATTGGCAGG - Intergenic
1021499484 7:21314983-21315005 TTTTATAAGAAGACGTTGGCTGG - Intergenic
1021620751 7:22549542-22549564 CTTTTAAGGCAAACATAGGCAGG - Intronic
1022299413 7:29089237-29089259 GTTTTTAAACAGAGATTGGGTGG + Intronic
1023718874 7:43072595-43072617 CTTTTTAAGCAGCCAGTGGCCGG + Intergenic
1024409725 7:49026413-49026435 CTTTTTAAGGAAATTTTGGCAGG - Intergenic
1026713029 7:72759715-72759737 CTTTTTAAGAATATCTTGGCTGG - Intronic
1028088474 7:86667909-86667931 CTCTTTAAGCAGACACCGGAGGG + Intronic
1028591559 7:92501493-92501515 TTTTTTAAACATACCTTGGCAGG + Exonic
1031340684 7:120596291-120596313 CTTTTTAAGCAGACATTGGCTGG - Intronic
1031463879 7:122084459-122084481 CTTTTTAAGAACAGATAGGCAGG + Intronic
1032150790 7:129427781-129427803 CTTCCTGAGCAGACGTTGGCTGG - Exonic
1032718022 7:134527567-134527589 CTTCTTAAGCAGCCTGTGGCCGG + Intergenic
1037194368 8:16170051-16170073 CTTTTTATGCAAAAATAGGCCGG + Intronic
1038155401 8:24984623-24984645 CTTTTTAAGCCAACAGTGGGAGG + Intergenic
1038818145 8:30927561-30927583 CTTTTTAAACAAAAATTGGATGG - Intergenic
1040448056 8:47516103-47516125 CTTAAAAAGCAGACACTGGCCGG - Intronic
1042683891 8:71416339-71416361 CTGTTTACACAGACATAGGCAGG - Intronic
1044393229 8:91678089-91678111 CTATTTAAGCAAAAATTGGCGGG + Intergenic
1044782093 8:95753497-95753519 GTTTTTTATCAGACAGTGGCAGG - Intergenic
1044928656 8:97231184-97231206 CATTTTAAAAAGACAGTGGCTGG + Intergenic
1047071205 8:121345303-121345325 GTTTTTAATCAGATATTGGCAGG + Intergenic
1047491146 8:125375738-125375760 CTTTTTAAAAAACCATTGGCTGG + Intergenic
1047533427 8:125697831-125697853 CTTTTTAAGAGCACATTGGTGGG + Intergenic
1050896010 9:10886542-10886564 CTTTTTAAGAAGAAATTGCTGGG - Intergenic
1055341350 9:75287417-75287439 CTTATGAAGCATATATTGGCTGG + Intergenic
1058719528 9:107751075-107751097 GTTTTTAACCAGAATTTGGCTGG + Intergenic
1059122164 9:111650790-111650812 CTTCTTAAGCAGGTTTTGGCTGG - Intronic
1060008488 9:120022038-120022060 CTTTTTATGAAGCAATTGGCTGG + Intergenic
1060032961 9:120231587-120231609 ATTATGAAGCAGACATTGGAAGG + Intergenic
1060235352 9:121858818-121858840 CTTTTCAAGCTGACATGGGCAGG + Intronic
1061454525 9:130687765-130687787 CTTTTTCAGCAGGCATTTGCTGG - Intergenic
1188179792 X:27040479-27040501 GTTTTTAAGCATAATTTGGCGGG - Intergenic
1189118298 X:38366571-38366593 CATGTAAAGCAGACATTGTCTGG - Intronic
1190814680 X:53919473-53919495 CTTTTGATGCAGACATTCGCAGG + Intergenic
1190913977 X:54796280-54796302 CTTTTTAAACAAACATTTCCTGG - Intronic
1191762427 X:64660459-64660481 CTTATTAAGCTTACGTTGGCTGG + Intergenic
1191798554 X:65051778-65051800 TTTTTTAAGGACACTTTGGCAGG + Intergenic
1192636224 X:72821623-72821645 ATTTTAAAGCAGATATTGGCAGG - Intronic
1192645490 X:72899191-72899213 ATTTTAAAGCAGATATTGGCAGG + Intronic
1195610015 X:106855772-106855794 CTTTTGAAGCATAATTTGGCAGG - Intronic
1196006482 X:110842805-110842827 TTTTTAAAGCACACATTGTCAGG + Intergenic
1199753387 X:150842475-150842497 CGTTTCAATCAGGCATTGGCAGG - Intronic