ID: 1031341141

View in Genome Browser
Species Human (GRCh38)
Location 7:120603546-120603568
Sequence TGCCCTATGCTACTTCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031341141_1031341142 -6 Left 1031341141 7:120603546-120603568 CCAGGGAGAAGTAGCATAGGGCA 0: 1
1: 0
2: 1
3: 19
4: 117
Right 1031341142 7:120603563-120603585 AGGGCAGTAGAAAGAGCTAAAGG 0: 1
1: 0
2: 0
3: 17
4: 375
1031341141_1031341144 16 Left 1031341141 7:120603546-120603568 CCAGGGAGAAGTAGCATAGGGCA 0: 1
1: 0
2: 1
3: 19
4: 117
Right 1031341144 7:120603585-120603607 GTCAGCAATGAGATAGGCATTGG 0: 1
1: 0
2: 2
3: 13
4: 154
1031341141_1031341143 10 Left 1031341141 7:120603546-120603568 CCAGGGAGAAGTAGCATAGGGCA 0: 1
1: 0
2: 1
3: 19
4: 117
Right 1031341143 7:120603579-120603601 CTAAAGGTCAGCAATGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031341141 Original CRISPR TGCCCTATGCTACTTCTCCC TGG (reversed) Intronic
900639265 1:3681102-3681124 TGGCCTGTGCCACTTCTCCAGGG + Intronic
901864823 1:12098202-12098224 TAACCTTTGCTACTTCTTCCAGG - Intronic
904320606 1:29695608-29695630 TGCCCTAGGAAACTTCACCCAGG - Intergenic
906133813 1:43480519-43480541 TGCACTTTGCTAATTCTCCAGGG + Intergenic
911101443 1:94098859-94098881 TGCCCTGTGCTCCCTCTCCCAGG - Exonic
911865358 1:103012340-103012362 TTCCCTGTGCAACTTCTTCCAGG - Intronic
915076118 1:153309164-153309186 TGCCATTGGCTACTGCTCCCAGG - Intronic
915264037 1:154702133-154702155 TGCCATATTCTAATTCTCCAAGG - Exonic
915555319 1:156657878-156657900 TGCCCTGTGCCTCTTCTCCCTGG + Intronic
916480512 1:165210282-165210304 TGCCTTTTCTTACTTCTCCCAGG - Intronic
916702967 1:167317260-167317282 TGACCTATTCTTTTTCTCCCTGG + Intronic
916719569 1:167474175-167474197 TGCCCTCTTTTTCTTCTCCCTGG + Intronic
918294654 1:183144934-183144956 TTCACTCTGCTGCTTCTCCCAGG + Exonic
919131177 1:193452475-193452497 TGGCCTATGCTTTTTATCCCAGG - Intergenic
1063339944 10:5253598-5253620 TGCTCTGGGCTACCTCTCCCAGG - Intergenic
1063343794 10:5293053-5293075 TGCTCTGGGCTACCTCTCCCAGG + Intergenic
1063647131 10:7896353-7896375 TGTCCTGTGCAACTACTCCCAGG + Intronic
1066500693 10:35991464-35991486 TGCCCTAGGCTGACTCTCCCAGG - Intergenic
1068855926 10:61797418-61797440 TGCCTTATTCTACATATCCCTGG + Intergenic
1075395120 10:122121492-122121514 TGCCCTATCCTACCTCTCCAGGG + Intronic
1078665678 11:13323160-13323182 TGCCCTGTGCTCCTTCTGCCTGG - Intronic
1081806009 11:45890920-45890942 TGCCCTCTGCTCAGTCTCCCTGG - Intronic
1088455643 11:110030383-110030405 TGGCCTCTACTCCTTCTCCCAGG - Intergenic
1088511369 11:110579261-110579283 ATCCTTATGCTACCTCTCCCAGG + Exonic
1090801348 11:130174473-130174495 GGCCCTCTGCTGCTTCTCCTGGG + Intronic
1093284030 12:17235170-17235192 TGCACACTTCTACTTCTCCCTGG + Intergenic
1095977292 12:47948501-47948523 TGCTCTATGTTACTTCCTCCAGG - Intergenic
1096002248 12:48139740-48139762 TGCCCTATGGAACTTCCCTCTGG + Intronic
1096454023 12:51770452-51770474 TGCCCTCTCCTCCATCTCCCAGG - Intronic
1098569070 12:71968613-71968635 TGCCCTACTCCACTTCTCGCAGG + Intronic
1104654565 12:130564175-130564197 TGCCCTCTTCCTCTTCTCCCAGG + Intronic
1107202445 13:37737947-37737969 TGCCCTAAGCTACTTATTCCAGG + Intronic
1112141149 13:96644329-96644351 GGTCATATGTTACTTCTCCCAGG + Intronic
1112583277 13:100694805-100694827 TTCCCTCTGCTTCTTCTCCACGG + Intergenic
1112633608 13:101189246-101189268 TTCCCTATACCTCTTCTCCCAGG - Intronic
1114512622 14:23275394-23275416 TGCCCTATGGTCATTCTCCCTGG + Exonic
1118599992 14:67465287-67465309 GCCCCTATGTTACCTCTCCCTGG - Intronic
1118887407 14:69878816-69878838 TGTCCCTTGCGACTTCTCCCGGG + Intronic
1120080908 14:80215207-80215229 TGCCCTAGGCTGCTTCTCTTTGG - Intronic
1122951373 14:105047026-105047048 TGGCCTATGCGGCCTCTCCCTGG + Intergenic
1129075703 15:72994083-72994105 TGCCCCAGGCTATTTCTACCCGG + Intergenic
1131072861 15:89477010-89477032 TGCCCTTTGCTTCTCCACCCAGG + Intronic
1132120391 15:99170649-99170671 TGCCCTCTCTTATTTCTCCCTGG + Intronic
1132938810 16:2496808-2496830 GCCCCTCTGCTACTTCGCCCGGG + Exonic
1132983187 16:2749659-2749681 TTGCCTATGCTTGTTCTCCCAGG - Intergenic
1133631808 16:7629148-7629170 GGCCCTGGGCTGCTTCTCCCTGG + Intronic
1133737787 16:8629064-8629086 TGCCTTGTGCTTCCTCTCCCAGG - Exonic
1134008982 16:10837241-10837263 TGCACTGTGCTGCTTCTCCCAGG + Intergenic
1140494859 16:75376569-75376591 TGCCCTATGCTCTTTGCCCCAGG - Intronic
1140567536 16:76061572-76061594 TGCACTATGTTCTTTCTCCCAGG + Intergenic
1141110402 16:81266805-81266827 TGCCCCATCCTGCTCCTCCCAGG + Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1148683468 17:49487530-49487552 TGGCCTCTGCTCCTGCTCCCTGG - Intergenic
1151512932 17:74572638-74572660 TCACCTGTGCTCCTTCTCCCTGG + Intergenic
1152799631 17:82324720-82324742 GGCTCCAGGCTACTTCTCCCGGG - Exonic
1153264757 18:3259249-3259271 TGCCCTTTGCCCCTTCTCACTGG - Intergenic
1153551828 18:6270637-6270659 TTGCCCATGCTGCTTCTCCCTGG - Intronic
1160091298 18:75829313-75829335 GGCCCTATGCCAATTCTTCCCGG - Intergenic
1160699253 19:498169-498191 TTCCCTATGCCACCTCTTCCTGG + Intronic
1160983186 19:1826144-1826166 TGCCCAAGGCTACCTCTCCTGGG + Intronic
1161600234 19:5177724-5177746 TGCCCTGTGCTCCTTCTCCAGGG - Intronic
1163493342 19:17630246-17630268 TGCCCTATTCTCCTGCTCCGTGG - Exonic
1166331025 19:42078096-42078118 TGGCCTCTGCTCCTTCTCCCAGG - Intronic
1166669594 19:44701838-44701860 TGCCCTAAGCTACATCTTCCGGG - Intronic
1167557768 19:50206319-50206341 TGCCCTATGCCTCTCCTCCCTGG - Intronic
926161563 2:10493674-10493696 GGCCCTGTGCCACCTCTCCCCGG + Intergenic
927642219 2:24852502-24852524 TGCCCTGTGCTACTCCTCACAGG + Intronic
928168622 2:28988988-28989010 TGCTCAATGCTGCTGCTCCCTGG + Intronic
928417521 2:31108519-31108541 TTCCCTATGCTACTCCTTCAAGG + Intronic
928757859 2:34547407-34547429 TGCCATATGAGAATTCTCCCGGG - Intergenic
932007951 2:67946456-67946478 TGACCTCTGTTACTTCTACCAGG + Intergenic
932381868 2:71291588-71291610 TGCCTTGTGCTCCTTCTCCCTGG + Intronic
933210140 2:79557125-79557147 TGACCTATTCTACTTCCCACAGG - Intronic
933721774 2:85401683-85401705 TGCCCTCTCCCACTTGTCCCAGG - Exonic
933836696 2:86251604-86251626 TGCCCTCTTCTGTTTCTCCCAGG + Intronic
934529381 2:95075532-95075554 TGCCCCAAGCGACTTCTCCAGGG + Intergenic
938977145 2:136490804-136490826 TGACCTATACTTCTTATCCCTGG + Intergenic
943799045 2:192034848-192034870 TGCCCTATCCTGCTTTTCACTGG + Intronic
947084007 2:226430345-226430367 TACCCCATGATCCTTCTCCCAGG + Intergenic
948777739 2:240298458-240298480 TGCCAAAGGCTACGTCTCCCTGG + Intergenic
1169068596 20:2708116-2708138 TGCTCTCTGCTGCTGCTCCCTGG + Intronic
1170945764 20:20889739-20889761 TGCCCTCTGCTGCTCCTCCACGG + Intergenic
1171114719 20:22515428-22515450 GGGCCTTTGCTCCTTCTCCCAGG - Intergenic
1172645967 20:36469837-36469859 GGCCATCTGCTCCTTCTCCCTGG + Intronic
1173240679 20:41294123-41294145 TCCCCTGAGCTACTACTCCCTGG - Intronic
1177132848 21:17278906-17278928 TGCACCATGCCACTGCTCCCAGG - Intergenic
1184474364 22:44712505-44712527 TCCCCTGTGCTCCTTCTCCCAGG - Intronic
950945707 3:16944002-16944024 TTGCCTATTCCACTTCTCCCAGG - Intronic
951583008 3:24185816-24185838 TGCCCTACTGTACTTCTCTCTGG - Intronic
955035897 3:55267318-55267340 TGCCCTGCTCTACTTCTCCCTGG + Intergenic
960025024 3:112998936-112998958 TGCACTATGTTACTTGTCTCTGG + Intronic
961383505 3:126510758-126510780 CGCCCTGCGCTACTTCCCCCCGG - Exonic
962250239 3:133831801-133831823 TGCCCAATGTCCCTTCTCCCTGG + Intronic
962579363 3:136783906-136783928 TGCCCTCTGCTACTTCTCCTTGG - Intergenic
965201816 3:165668765-165668787 TGACTTATTCTACTTCTTCCAGG - Intergenic
965256660 3:166423119-166423141 TTGCTTATGCTACTTCTGCCTGG - Intergenic
965906676 3:173716586-173716608 TGCCTGATACTACTTCTTCCCGG + Intronic
967851728 3:194087685-194087707 TGCCTTTTGCTACATCTGCCTGG - Intergenic
972675551 4:41256942-41256964 TTCCCTAGGCTATTTCTGCCGGG + Exonic
974697707 4:65397181-65397203 GGCCCTGGGGTACTTCTCCCTGG + Intronic
975296868 4:72744725-72744747 TGCCCTATCCTGCTTCTCCAGGG + Intergenic
975975371 4:80089554-80089576 TGCTCTATGCTTCTGTTCCCTGG - Intronic
978318061 4:107462266-107462288 TTCCCTTGGCTCCTTCTCCCTGG - Intergenic
981413492 4:144460128-144460150 TGCCCTTTGCTTCCTCACCCTGG - Intergenic
983319398 4:166176672-166176694 TGCCCGTTGCTTCTTCTTCCAGG + Intergenic
984270945 4:177548192-177548214 TGTCCAATCATACTTCTCCCTGG + Intergenic
989683928 5:44062577-44062599 TGGTCTATGCAACTTCTTCCTGG + Intergenic
990661117 5:58016517-58016539 TGCCCTATGGAAGTTATCCCAGG - Intergenic
991088595 5:62671562-62671584 TGCCCAATGTTCCTTCTCCCAGG - Intergenic
994233650 5:97336950-97336972 TGCCATCTGCTACTTCTTTCTGG + Intergenic
995730214 5:115231163-115231185 TGCCTAATTCTACTTCTCCATGG - Intronic
997474474 5:134134599-134134621 GGCCCTTGGCTCCTTCTCCCTGG + Intronic
1000302664 5:159970459-159970481 TACCCCATTCTACTTTTCCCAGG + Intronic
1005712485 6:28515374-28515396 TCCCCTTTGCCACTTCCCCCTGG - Intronic
1008753526 6:54766033-54766055 TTCCCTATACTCTTTCTCCCAGG + Intergenic
1013454684 6:110319891-110319913 TGCCCTATGCCTCTGCTCCCGGG + Intronic
1026114500 7:67484776-67484798 TGCACCCTGCTACTTTTCCCAGG - Intergenic
1026440348 7:70438501-70438523 TGCCCCATGCCATTTCTCCAGGG + Intronic
1030010812 7:105165131-105165153 TGCTCTCTGTCACTTCTCCCTGG + Intronic
1031341141 7:120603546-120603568 TGCCCTATGCTACTTCTCCCTGG - Intronic
1031936904 7:127744599-127744621 TGCCCTATGCTTTTTCTCAAAGG + Intronic
1034983742 7:155494833-155494855 TGCCCGATGCCAGGTCTCCCTGG + Intronic
1039920328 8:41889221-41889243 AGCACTAGGCTACTTCCCCCAGG - Intronic
1039980170 8:42402622-42402644 TGCCCTTTGCTTTTTCTTCCTGG - Intronic
1041098984 8:54377952-54377974 TGCCCAGTCCTGCTTCTCCCTGG + Intergenic
1041456074 8:58061736-58061758 TCCCATGTGCTCCTTCTCCCAGG + Intronic
1057129515 9:92643295-92643317 TGCCCTGTGCTACTTCTTCTAGG - Intronic
1057955678 9:99405840-99405862 TGGCCTTTCTTACTTCTCCCTGG + Intergenic
1058164716 9:101606456-101606478 AGCCCTCTCCTATTTCTCCCTGG + Intronic
1059349282 9:113653042-113653064 TGCCCAATGCTGATTATCCCTGG + Intergenic
1061161245 9:128895643-128895665 TGCCCACTTCTACATCTCCCTGG + Intronic
1062363319 9:136197633-136197655 AGCCCTGGGCAACTTCTCCCTGG - Exonic
1062673602 9:137726034-137726056 TGACCTTGGTTACTTCTCCCTGG + Intronic
1190187075 X:48244528-48244550 TGCCTTTTGCTATTTTTCCCAGG + Intronic
1190194829 X:48307815-48307837 TGCCTTTTGCTATTTTTCCCAGG + Intergenic
1190661261 X:52656072-52656094 TGCCTTTTGCTATTTTTCCCCGG + Intronic
1192153116 X:68724193-68724215 TGCCCCATGCTATTGATCCCTGG + Intronic
1193643037 X:84034910-84034932 TGCCCTTTACTACATCTCCTGGG - Intergenic