ID: 1031345407

View in Genome Browser
Species Human (GRCh38)
Location 7:120659605-120659627
Sequence TACTTAGTATTCTCTACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031345407 Original CRISPR TACTTAGTATTCTCTACTCC TGG (reversed) Intronic
903921258 1:26802855-26802877 TCCTTAGAGTCCTCTACTCCCGG + Intergenic
904640051 1:31919658-31919680 TACTTATTCTTTTCTTCTCCAGG - Exonic
906968636 1:50486159-50486181 TACTTAATATTTTCTACTTAAGG + Intronic
909379554 1:74982684-74982706 TTGTAAATATTCTCTACTCCAGG + Intergenic
909953158 1:81744614-81744636 ATCTTAGTGTTCTCTACTCCAGG + Intronic
911651926 1:100398775-100398797 ACCTTAGTATCCTCAACTCCAGG - Intronic
912983222 1:114399003-114399025 AACTTAGTATTATATACTCTGGG + Intronic
914833344 1:151187131-151187153 TACTTCACGTTCTCTACTCCAGG - Intronic
914943891 1:152046995-152047017 TACATAGTATTCTATAATACAGG + Intronic
916680703 1:167102483-167102505 TATTATTTATTCTCTACTCCTGG - Intronic
918170930 1:181996812-181996834 CACTTAATCTTCTCTACTACAGG + Intergenic
920965818 1:210699740-210699762 TTTTTATTATTCTTTACTCCAGG - Intronic
923434355 1:233954417-233954439 TCCTTAGTATTCTCTTTCCCTGG - Intronic
923900429 1:238320360-238320382 CACTTAATAAACTCTACTCCAGG + Intergenic
1064575061 10:16736447-16736469 TCCTTACTAGTCTTTACTCCTGG - Intronic
1065482050 10:26205544-26205566 CACTTAGCATTCTGTCCTCCAGG + Intronic
1068396825 10:56472865-56472887 TACTTATTATTCTATATTCCTGG - Intergenic
1068472608 10:57483872-57483894 TACTCAGTGCTCTCTACTCGGGG + Intergenic
1078178742 11:8991647-8991669 CACTTAGCTTTCTCTAGTCCAGG - Intronic
1078748814 11:14140768-14140790 GACTTTGTATTTTCTTCTCCTGG + Intronic
1079636462 11:22747743-22747765 TACTTAGTTTACCCTACTTCTGG - Intronic
1081568030 11:44271827-44271849 TACTTAGTGAATTCTACTCCCGG + Intronic
1082137763 11:48569486-48569508 TATTTAGTATTCTCTTCTTGGGG - Intergenic
1083853250 11:65379754-65379776 GACTTGGTCTTCTCTCCTCCAGG + Intronic
1085217901 11:74848498-74848520 TAATTAGGATTCTCTCCTCCTGG + Intronic
1085512512 11:77095515-77095537 TCCTGAGCCTTCTCTACTCCAGG - Intronic
1087612496 11:100451652-100451674 TACCTGGAATACTCTACTCCTGG - Intergenic
1087865125 11:103216178-103216200 TTCTTAGAATTCTCTCCTTCAGG + Intronic
1088704669 11:112451250-112451272 TACTTTGTATTGTGTCCTCCTGG + Intergenic
1090185894 11:124738978-124739000 TACTTCGAATTCTCTACACTTGG + Intergenic
1090597944 11:128339375-128339397 TTCTTAGTATTCTTCACACCTGG - Intergenic
1096172304 12:49481821-49481843 TGCTAAATATTCTCTAATCCTGG - Intronic
1099163299 12:79272625-79272647 TACTCCCTATTCTATACTCCAGG - Intronic
1099273243 12:80540904-80540926 CACTTACTATGCACTACTCCAGG + Intronic
1101042074 12:100766147-100766169 TACCTAGCATTCTGTCCTCCAGG + Intronic
1103646281 12:122395784-122395806 TTCTTAGTATTCTTTACTGGAGG + Intronic
1104082964 12:125447670-125447692 TATTTAGTAGTCTCTGCTACAGG + Intronic
1106131548 13:26943857-26943879 AACTGAGCATTATCTACTCCAGG + Intergenic
1106925325 13:34607415-34607437 TACTTGGTTTTCTCTAATCTGGG + Intergenic
1108998007 13:56759792-56759814 GACTTTGTATTCTCCTCTCCAGG + Intergenic
1109199693 13:59416510-59416532 TACTTAACAATCTCTAATCCAGG - Intergenic
1110416347 13:75257600-75257622 TACTTATTATTCTCTCTACCTGG - Intergenic
1112500787 13:99941529-99941551 TACTTAATATTCTTGACTCTTGG + Intergenic
1115519624 14:34220554-34220576 TTCTTAGCATTCTCTGTTCCTGG - Intronic
1120878342 14:89394740-89394762 AAGTTACTATTCTCTAATCCCGG + Intronic
1125576516 15:40759389-40759411 AATTTAGTCTTCTGTACTCCTGG + Intergenic
1127318799 15:57822282-57822304 TACTAAGTTTTCTCTATTCCGGG + Intergenic
1130793440 15:87181427-87181449 TACTTAGTCATTTCTTCTCCTGG - Intergenic
1131367458 15:91853130-91853152 TACTCAGTATTCTCCCTTCCTGG + Intergenic
1135782957 16:25322332-25322354 CTCTTAGCATTCTCTTCTCCAGG - Intergenic
1138258366 16:55591730-55591752 TCCATAGTATTCTTTACTCTAGG + Intergenic
1141525914 16:84611734-84611756 TACTTGGTATTCTCTTCTTTTGG + Intronic
1142631242 17:1228298-1228320 AACTTAGTCTCCTCTTCTCCAGG - Intronic
1144084270 17:11794507-11794529 TCCTGAGTCTTCTCTTCTCCAGG + Intronic
1146532737 17:33623775-33623797 TTCTTCTTTTTCTCTACTCCAGG + Intronic
1147550250 17:41436828-41436850 TCCTGAGTTTTCTCTACTTCAGG - Exonic
1147911881 17:43860994-43861016 AGCTTAGTATTCTCCCCTCCCGG + Intronic
1148638600 17:49168244-49168266 TTCCTAGTATTTTCTGCTCCTGG - Intronic
1152628042 17:81397148-81397170 TTCTTTGTGTTCTCTCCTCCCGG - Intronic
1155490897 18:26400955-26400977 CACTTATTATTCCCTTCTCCAGG + Intergenic
1155791688 18:29979387-29979409 TTCTTAGTTTTCTCTATTACTGG + Intergenic
1156156939 18:34314387-34314409 TACTTTGTATTCCCTACTAAGGG - Intergenic
1158670093 18:59466902-59466924 AACTTAGTATTCTCTACATTTGG - Intronic
1164830371 19:31315413-31315435 TACTCAGGAAGCTCTACTCCTGG + Intronic
1165205559 19:34182419-34182441 TATTTAGAATTCTCTATTCCTGG + Intronic
1167251748 19:48402415-48402437 TCCTTAAGATTCTTTACTCCTGG + Intronic
930350487 2:50247693-50247715 TTCTTAGTTTTCTCTAATCTAGG - Intronic
931917015 2:66967329-66967351 TTTTTAGTATTTTCTATTCCAGG - Intergenic
932198174 2:69802239-69802261 TAACTAGTATTCTTAACTCCTGG - Intronic
932424415 2:71620062-71620084 TACTCAGTCTTCCCTCCTCCAGG - Intronic
940994905 2:160137851-160137873 TAATTAGTATTTTCTTTTCCAGG - Exonic
941409376 2:165134104-165134126 TACTGAGTATTTTCTCCTGCTGG - Intronic
942500232 2:176581582-176581604 AACCTGGTATTCTCTATTCCAGG + Intergenic
943278561 2:185900291-185900313 GACTTAATAGTTTCTACTCCTGG + Intergenic
943762442 2:191624569-191624591 CTCTTACTTTTCTCTACTCCAGG + Intergenic
945134333 2:206610580-206610602 CACTTAGTATTTTCTAATCAAGG + Intronic
945920335 2:215749149-215749171 TACTTAGGATTCTCCACTTAGGG - Intergenic
946616679 2:221517569-221517591 TACTTGGAACTCTCGACTCCCGG - Intronic
947107579 2:226683647-226683669 TACTTAGTCTTTTCTACTCCAGG - Intergenic
1168739034 20:172602-172624 TACTTAGTATAATGTCCTCCAGG + Intergenic
1172499244 20:35413232-35413254 TACTTTGTCTTCTCTTCTCTTGG - Intergenic
1174982088 20:55407863-55407885 TACTTCGCATTCCCAACTCCAGG - Intergenic
1177628257 21:23693055-23693077 TACTTAGCATACTGTCCTCCAGG + Intergenic
949650530 3:6153658-6153680 CTCTGAGTAGTCTCTACTCCAGG - Intergenic
950225382 3:11229267-11229289 CACACAGTATTCTCTTCTCCAGG - Intronic
951425397 3:22538759-22538781 TCCTTATTTTTCTCCACTCCAGG + Intergenic
952032689 3:29163160-29163182 CACTTACTATTCTTTAATCCTGG - Intergenic
954173815 3:48826839-48826861 AACTTAAAACTCTCTACTCCAGG + Intronic
955004457 3:54955938-54955960 AAATTGGTATTCTCCACTCCAGG + Intronic
956820081 3:72946381-72946403 GACTTAGTCTTCTCTACGACTGG - Intronic
957105971 3:75887798-75887820 TAATTTATATTCTCCACTCCAGG + Intergenic
959208309 3:103342160-103342182 TACATAGTATACTGTTCTCCTGG + Intergenic
961988707 3:131164951-131164973 TACTTTGTTTTCTCTATTACAGG - Intronic
964975951 3:162621068-162621090 TGCTTAGTGTTCTCTAATCCAGG + Intergenic
965006701 3:163035770-163035792 TGCTTAGTATTCTATAGTGCAGG - Intergenic
966241677 3:177761411-177761433 CACTTAGCAGTCTCTACTTCTGG - Intergenic
974538539 4:63201608-63201630 TACATAGTATACTCTACTATAGG - Intergenic
975353711 4:73374851-73374873 TACTAAGAATTACCTACTCCTGG - Intergenic
975416483 4:74111089-74111111 TTCTTGGTAGTCTCAACTCCTGG - Intergenic
979785958 4:124715442-124715464 TACTTGCTATACTCTACTACAGG + Intergenic
979821176 4:125173400-125173422 TATTTAGGCTTCTCTTCTCCAGG + Intergenic
980325352 4:131337922-131337944 GACTTAATATTCTATATTCCTGG - Intergenic
980381902 4:132032610-132032632 TACTTAGTATTTTGGACTCTGGG + Intergenic
980893543 4:138839512-138839534 TACTTAGTATTCTCAAAACATGG + Intergenic
981303804 4:143223886-143223908 AACTTACTCTTCTCTACTTCAGG - Intergenic
986097770 5:4576929-4576951 AAGTTAGTGTTCTCTTCTCCAGG - Intergenic
987160862 5:15140678-15140700 TACTTAGTATAATGTCCTCCAGG - Intergenic
989591250 5:43114985-43115007 TACTTAGTAAACTCTAATTCTGG - Intronic
989668480 5:43886025-43886047 TACTTTGCATTATCTCCTCCTGG - Intergenic
995116584 5:108487417-108487439 TACTTATTGTTCTCTACTTGGGG + Intergenic
996393508 5:122989077-122989099 TACTTAGTATTCTGTTCTATGGG + Intronic
998437177 5:142120952-142120974 ACCTGAGTATGCTCTACTCCAGG + Intronic
1000990093 5:167902875-167902897 TACATATTATTCTGTACTCCTGG + Intronic
1004787210 6:18982612-18982634 TAATGAGGATTTTCTACTCCAGG - Intergenic
1010950595 6:82032779-82032801 CTCTTGCTATTCTCTACTCCTGG - Intergenic
1013552245 6:111219076-111219098 TTCATAGTATTTTCTACTTCAGG + Intronic
1016605945 6:145926443-145926465 TACTTTGTTTTCTTTACTCAAGG + Intronic
1017610306 6:156178361-156178383 CACTTAGTATAATCTCCTCCAGG + Intergenic
1018365341 6:163114565-163114587 TACTTAGTATAATGTCCTCCAGG - Intronic
1027531275 7:79336731-79336753 TACTTAGTATGATGTCCTCCAGG + Intronic
1028097871 7:86784725-86784747 CATTTAGTATTCTTTAATCCAGG - Intronic
1029980643 7:104875438-104875460 TACTTATTAGTCTTGACTCCAGG + Intronic
1030282140 7:107787911-107787933 TGCTTAGTATGCTCAATTCCTGG + Intronic
1031345407 7:120659605-120659627 TACTTAGTATTCTCTACTCCTGG - Intronic
1033559130 7:142514603-142514625 TCCTCAGTATTCTCCTCTCCTGG + Intergenic
1034597731 7:152214663-152214685 TATTTAGTATACTTTCCTCCCGG - Intronic
1035003681 7:155638734-155638756 TACTTTTTATTCTCTCCTTCTGG + Intronic
1039064064 8:33594249-33594271 CCCTTAGTCTTCTCTTCTCCAGG - Intronic
1039298464 8:36183324-36183346 TACTTAGCATAATCTCCTCCAGG + Intergenic
1041433215 8:57807834-57807856 TACTTAGCATTCTGTCCTGCAGG - Intergenic
1042447514 8:68903662-68903684 GAGTGACTATTCTCTACTCCAGG + Intergenic
1043815279 8:84793664-84793686 TATTGAATATTATCTACTCCTGG - Intronic
1044573426 8:93744092-93744114 TCCTTAATCTTCTCAACTCCTGG + Intergenic
1044737285 8:95292179-95292201 TACTTAGCATTATGTACTCAAGG - Intergenic
1046021785 8:108674064-108674086 TACCTAGTTTTGTCAACTCCAGG - Intronic
1047260578 8:123255549-123255571 AACTTAAAATTCTCTTCTCCTGG + Exonic
1047593527 8:126352512-126352534 TACCTTGGATTGTCTACTCCTGG - Intergenic
1048175887 8:132152452-132152474 TTGTGAGTATTCTCTACTCATGG + Intronic
1048313602 8:133345518-133345540 CAATTAATATTCTCAACTCCAGG + Intergenic
1051100687 9:13517810-13517832 TACTCAGTGTTCTCTCATCCAGG + Intergenic
1052446154 9:28564348-28564370 TATTTAGAATTATCTACTCCCGG - Intronic
1053588831 9:39489610-39489632 TCCTTAATTTTCTCAACTCCAGG + Intergenic
1054577472 9:66875685-66875707 TCCTTAATTTTCTCAACTCCAGG - Intronic
1054955624 9:70906538-70906560 TACATATTATTCTCTAGTCCTGG - Intronic
1059345969 9:113628188-113628210 TACTGAGTGATCTCTACCCCTGG - Intergenic
1060658259 9:125387735-125387757 TCCTTAAGATTCTCTTCTCCTGG + Intergenic
1192500566 X:71647845-71647867 CACTTAGTATAATGTACTCCAGG - Intergenic
1193043346 X:77026663-77026685 TACATAGTGTTCTTTAATCCAGG - Intergenic
1195012613 X:100748015-100748037 TACTTAGTATAATGTCCTCCAGG + Intergenic
1195334534 X:103838024-103838046 TACATAGTATTTCCTACTCTGGG - Intergenic
1197433553 X:126396953-126396975 TACTTAGTATAATGTTCTCCAGG + Intergenic
1198894685 X:141439991-141440013 TACTGAATATTATCTACTACAGG + Intergenic
1199256125 X:145720771-145720793 TATTATGTATTCTCTACACCAGG - Intergenic
1199891772 X:152090786-152090808 TATTTAGTATTGTTAACTCCTGG + Intergenic
1200175600 X:154113742-154113764 GACCTAGAATTCTGTACTCCCGG - Intergenic