ID: 1031346506

View in Genome Browser
Species Human (GRCh38)
Location 7:120673547-120673569
Sequence AATGATATGGAGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 910
Summary {0: 1, 1: 0, 2: 3, 3: 81, 4: 825}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031346506_1031346512 14 Left 1031346506 7:120673547-120673569 CCATCCTCCTTCTCCATATCATT 0: 1
1: 0
2: 3
3: 81
4: 825
Right 1031346512 7:120673584-120673606 TGTTGTATCAACCTCCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031346506 Original CRISPR AATGATATGGAGAAGGAGGA TGG (reversed) Intronic
900091383 1:922226-922248 AGTGATTTGGAGAGGGAGGCTGG - Intergenic
902090301 1:13897845-13897867 AAGGACCTGGAGAGGGAGGAAGG - Intergenic
902691538 1:18112937-18112959 AAGGAGGTGGAGAGGGAGGATGG - Intronic
902968498 1:20029649-20029671 AATGATATGGAAGGGGAGAAGGG - Intronic
902980885 1:20122105-20122127 GATGATGAGGAGGAGGAGGACGG - Intergenic
903506100 1:23837088-23837110 AATGATATGGAAAGGAGGGAAGG + Intronic
903506250 1:23837816-23837838 AATGATATGGAAAGGTGGGAAGG + Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904939111 1:34152453-34152475 GAGGATTTGGAGAAGGGGGATGG - Intronic
905019784 1:34801071-34801093 AAGGCTCTGAAGAAGGAGGAAGG + Intronic
905164584 1:36071491-36071513 AATAGTGTGGAAAAGGAGGATGG - Exonic
905661350 1:39728445-39728467 AATGATACGGAAAAGGGGGAGGG - Intronic
905741493 1:40374642-40374664 AATGACGAGGAGGAGGAGGAGGG + Intronic
906005664 1:42467535-42467557 TATGAAATAGAGAAGGAGGAGGG + Intronic
906136959 1:43506548-43506570 AGTGATGTGGAGAAGGAGCTTGG - Intergenic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906291870 1:44624662-44624684 AAGGACAGGGAGAAGGAGGGAGG + Intronic
906726406 1:48047676-48047698 ACTGAGATGGAGGAGGATGAGGG + Intergenic
906977061 1:50587148-50587170 CAGGATTTGGAGAAAGAGGATGG - Intronic
907110419 1:51921869-51921891 AATAATAGGGAGAAAGAGGGAGG - Intronic
907603847 1:55795677-55795699 ATTGATATGGGGAATTAGGAAGG + Intergenic
907656988 1:56353629-56353651 GAGGATTTTGAGAAGGAGGAAGG - Intergenic
908353157 1:63306225-63306247 AATAAGGAGGAGAAGGAGGAAGG + Intergenic
908651478 1:66337570-66337592 AAGGACATGGGGAAAGAGGAGGG + Intronic
908870571 1:68606364-68606386 AATGATATTTAGTAGGTGGATGG + Intergenic
909263505 1:73526674-73526696 AATGATATGGAAGGGGAGAAGGG + Intergenic
909795186 1:79726420-79726442 AAAAATATGTGGAAGGAGGATGG + Intergenic
910604021 1:89063724-89063746 AATCATTTGAAGATGGAGGAAGG - Intronic
911323566 1:96443181-96443203 AATGAGGAGGAGGAGGAGGAGGG - Intergenic
911436457 1:97865531-97865553 AATCAGAGGGTGAAGGAGGATGG - Intronic
911470310 1:98309998-98310020 AATGACTTGGAGAACTAGGATGG - Intergenic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
911910529 1:103628583-103628605 ACTGAAATGGAGAGGGATGAGGG + Intergenic
911917945 1:103722708-103722730 ACTGAAATGGAGAGGGATGAGGG + Intronic
912131058 1:106600907-106600929 AATAAAATGAAGAAGCAGGATGG - Intergenic
912211160 1:107558550-107558572 AATGATCTCAAGAAGGAAGAGGG + Intergenic
912259143 1:108092051-108092073 AAAGAGGAGGAGAAGGAGGAAGG - Intergenic
912406281 1:109440828-109440850 ACTGATATGGAGAAGGCTGAAGG - Intergenic
912498481 1:110106568-110106590 AAGGAGCTGGAGCAGGAGGAAGG - Intergenic
912532868 1:110339098-110339120 AATGAAAGGGATAAGGAGGTGGG + Exonic
912870369 1:113299030-113299052 AATTATAGGGAGATGGAAGATGG + Intergenic
913575944 1:120175174-120175196 ACTGCTAAGGAGAAGGAAGAGGG - Intronic
913615209 1:120552412-120552434 AATGAGATGGAGAGGCAGGCAGG + Intergenic
913653960 1:120943993-120944015 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
914558258 1:148790745-148790767 ACTGCTAAGGAGAAGGAAGAGGG - Intergenic
914614577 1:149339485-149339507 ACTGCTAAGGAGAAGGAAGAGGG + Intergenic
914644153 1:149638161-149638183 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915326323 1:155082817-155082839 ACTGCTAGGGAGAAGGAGGGAGG + Intronic
915438256 1:155925764-155925786 AATGTCAAGGAGAAGGTGGAAGG - Exonic
915493642 1:156266038-156266060 GAAGATATGGAGGAAGAGGAGGG - Exonic
915755413 1:158255031-158255053 AAAGACATTGAGAAAGAGGATGG - Intronic
915770972 1:158423184-158423206 AATAAGATAGAGGAGGAGGAGGG - Intergenic
916157352 1:161866629-161866651 TATGATTTGGAGAGGGAGGTTGG + Intronic
916323349 1:163530446-163530468 GAAGAAATGGAGAAGGAGAAGGG - Intergenic
916429558 1:164713868-164713890 AATGATATGTCGAAGCAGGAAGG + Intronic
916803643 1:168237807-168237829 TAAGATATGGAGAAGGATGCTGG + Intronic
918703575 1:187635477-187635499 AGTGACAGGGAGAAAGAGGATGG - Intergenic
918739559 1:188110745-188110767 AAAGATAAGGAGAGGGATGAAGG + Intergenic
918762427 1:188428875-188428897 AATGATCTTGAGAAGAAGGAGGG - Intergenic
918876362 1:190049597-190049619 AAAGATAGGGAGCAGGATGAAGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919474167 1:198013965-198013987 AATGATCTGGACAAGGTAGAGGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919699228 1:200614161-200614183 AGTGGTATGGAGAGGGAGGGTGG - Intronic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920282591 1:204855326-204855348 AATGGGATTGAGAAGGAGAAAGG + Intronic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
921350328 1:214228050-214228072 ACAGATAGGGAGAAGGAAGAAGG + Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921472586 1:215567284-215567306 AATGAGGAGGAGGAGGAGGAAGG - Intergenic
921993827 1:221396073-221396095 GAAGAGATGGACAAGGAGGAAGG - Intergenic
922061254 1:222094564-222094586 GAAGCCATGGAGAAGGAGGATGG - Intergenic
922700147 1:227754503-227754525 AATGATATGGAAGAGGGGAAGGG - Intronic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922867873 1:228875940-228875962 AATAATAAGGAGGAGGAGGGAGG - Intergenic
922897452 1:229111452-229111474 CATGACATGGGGAAGGATGAAGG + Intergenic
923455703 1:234163328-234163350 AGTGTTAGGGAGAAAGAGGAGGG + Intronic
923570485 1:235108787-235108809 AATGCTTTGGAGAGGGTGGAAGG - Intergenic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
923847196 1:237748159-237748181 AACGATATGGGGAATGAGGGAGG + Intronic
924189987 1:241540633-241540655 AATGAACTGGAGAAAGAGGTTGG + Intronic
924649417 1:245911227-245911249 AAGGATGTGGAGAAAGGGGAAGG + Intronic
1062781121 10:208769-208791 AATGAGGTGGAGAAGGAAGAAGG + Intronic
1062791844 10:311669-311691 AATGGGATGGAGAAGAGGGAGGG + Intronic
1063267323 10:4467969-4467991 TGTGCTATGGAGAAGGAGGTAGG - Intergenic
1063790754 10:9443492-9443514 ACTGTTATGGACATGGAGGATGG - Intergenic
1063997051 10:11629278-11629300 AAAGAGATGGAGGAAGAGGAAGG - Intergenic
1064393064 10:14958138-14958160 AAAGACATGAAGAAGGAGCAGGG + Intergenic
1064445145 10:15386434-15386456 TATTATATGGAGAAAGAAGATGG + Intergenic
1064591441 10:16896127-16896149 AATGATATGGAAAAGTTGAAAGG - Intronic
1064921337 10:20522291-20522313 AAGGTTATGGAGAAAAAGGAAGG - Intergenic
1065050373 10:21785800-21785822 AAAAAGATGGAAAAGGAGGAGGG + Intronic
1065182541 10:23140873-23140895 AATGCTATGGAGAGGTCGGAGGG + Intergenic
1065352504 10:24808047-24808069 AATTATATGGAGAAGTAGAATGG + Intergenic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066453041 10:35548728-35548750 AAAGAGGTGGAGAAGGTGGAAGG + Intronic
1066965299 10:42258403-42258425 GAGGATATGGAGAAATAGGAAGG - Intergenic
1067130730 10:43563016-43563038 AATAATATGAAGAATGAGGCCGG + Intronic
1067410813 10:46063033-46063055 AATAGAATGGAGAAGCAGGATGG - Intergenic
1067426507 10:46215359-46215381 ACTGATGTGGAGTGGGAGGAAGG - Intergenic
1067572131 10:47379435-47379457 AATAAGAAGGAGCAGGAGGATGG + Intronic
1067814163 10:49459376-49459398 AATGAAAAGGGAAAGGAGGAGGG + Intronic
1068581166 10:58741267-58741289 ATTGATTTGCAGAAGGAGAAGGG + Intronic
1069930429 10:71877994-71878016 ATTGATGTGGTGAGGGAGGAGGG + Intergenic
1069979187 10:72240451-72240473 AAAGATGTGGAGACAGAGGATGG + Intergenic
1070026548 10:72637499-72637521 TATGAAAGGGAGAAGGAAGACGG + Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070555768 10:77526857-77526879 GGAGATATGGAGAGGGAGGATGG - Intronic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071268262 10:83983614-83983636 GCTGGAATGGAGAAGGAGGAGGG - Intergenic
1071394157 10:85205243-85205265 AATGATAATGAGGAGGAGAAAGG + Intergenic
1071809573 10:89164761-89164783 AAAGAAATGAAGAAAGAGGATGG + Intergenic
1072054962 10:91745729-91745751 AAAGAGAAGGAGAAGGAAGAAGG + Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072473349 10:95734558-95734580 AATTAAACGGAGAAGGGGGAAGG + Intronic
1073619762 10:105034836-105034858 AATTATATGAACAAGGGGGAGGG - Intronic
1074784666 10:116828422-116828444 AAGGAGATGGAGAGGTAGGAAGG - Intergenic
1075216236 10:120538674-120538696 AATGTAATGTATAAGGAGGAGGG - Intronic
1075359055 10:121813327-121813349 GTTGAGATGGAGAATGAGGAGGG - Intronic
1075554911 10:123423376-123423398 AAAGAAATGGAGAAGGCAGAGGG + Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076415890 10:130288234-130288256 AATGAACTGGAGCAGGTGGAAGG + Intergenic
1076510439 10:131010251-131010273 AATGTTATGGAGAATGAAGTAGG + Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1077736970 11:4801467-4801489 AATGAGAGAGAGAAGGGGGAGGG + Intronic
1078075829 11:8159517-8159539 ACTGAAGTGGGGAAGGAGGAAGG + Intronic
1078829070 11:14961714-14961736 AATGACATGGAGGAGGAAGATGG + Intronic
1079350190 11:19685496-19685518 AATGTTAAGGAAGAGGAGGAAGG + Intronic
1079691156 11:23418975-23418997 GATGATGAGGAGGAGGAGGATGG + Intergenic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1081022243 11:37960528-37960550 GCTGATATGGAGAAGGCTGAGGG + Intergenic
1081575772 11:44317807-44317829 AATGAAAGGGAGGAGGGGGAAGG - Intergenic
1081618478 11:44604531-44604553 TATTATATGGACAAGAAGGAAGG + Intronic
1082195700 11:49302239-49302261 AATGACATGGTGAGGGATGAGGG - Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082933682 11:58634782-58634804 AGTTATGTGGAGATGGAGGAGGG - Intergenic
1083209007 11:61171029-61171051 GATTCTATGGAGTAGGAGGAAGG - Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084919514 11:72457924-72457946 AAAGATATAGAGATAGAGGAAGG + Intergenic
1085068925 11:73523748-73523770 AATGAGATAGAAAAGGAAGAGGG - Intronic
1085728687 11:78977716-78977738 GAGGATGTGGAGAAAGAGGAAGG + Intronic
1085835141 11:79947777-79947799 AATGACATGAAGTAAGAGGAAGG - Intergenic
1085879404 11:80448214-80448236 AAGGATAGGGAGAAGGGGAATGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086164186 11:83758400-83758422 AAAGATATGGAAAAGGAACATGG - Intronic
1086282859 11:85210845-85210867 AATGGAAGGGAGAAGGAAGAAGG - Intronic
1086487155 11:87318613-87318635 AATATTATTCAGAAGGAGGATGG + Intronic
1086780004 11:90892273-90892295 AGGGATATGGAGAAGTATGAAGG + Intergenic
1086898867 11:92343798-92343820 TATGATATGGTGTAGGAGGAAGG + Intergenic
1087026992 11:93659917-93659939 AAAGGGATGGAGTAGGAGGAAGG - Intergenic
1087112122 11:94481970-94481992 AATGATATTCAGAAAGAGAAAGG + Intronic
1087285938 11:96265458-96265480 AATGATATGGAAGAGGGGAAGGG + Intronic
1087512419 11:99114462-99114484 GAAGAAAAGGAGAAGGAGGAAGG - Intronic
1087990715 11:104743407-104743429 GATGAACTGGAGATGGAGGAAGG + Intergenic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088103164 11:106176869-106176891 AATGATATGGAAACGGGGAAGGG + Intergenic
1088130600 11:106484634-106484656 CATGATGAGGAGAATGAGGATGG - Intergenic
1088280354 11:108128702-108128724 AATGATGTAGAGGAGAAGGAAGG + Intronic
1089042193 11:115462613-115462635 TTTGATGTGGAGGAGGAGGAGGG + Intronic
1089340583 11:117754695-117754717 AGTCATATGGGGAAGGAGGAGGG + Intronic
1089723394 11:120450966-120450988 AAAGATGAGGAGATGGAGGAGGG - Intronic
1089933598 11:122340130-122340152 AAAGAGAAGGAGGAGGAGGATGG + Intergenic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090339086 11:125999658-125999680 AATGAGAAGGAGAAAGATGATGG - Intronic
1090398640 11:126434874-126434896 GATGATGTGGAGAAGCGGGAAGG + Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1091909109 12:4214523-4214545 AAAGAAATGGAGAGGGAGCAGGG + Intergenic
1092454442 12:8630171-8630193 AGAAATATGGAGCAGGAGGATGG - Intergenic
1092560408 12:9607239-9607261 AAAGAAAAAGAGAAGGAGGAAGG - Intronic
1093412154 12:18879681-18879703 AATGATATTGAGGTGAAGGAAGG + Intergenic
1093603794 12:21064846-21064868 ACTGATATGGAGGCGGTGGAAGG + Intronic
1093744227 12:22721555-22721577 GAAGAGATGGAGAAGCAGGAGGG + Intergenic
1093804616 12:23416912-23416934 AATGAAATGGAGAGGTAGCAGGG - Intergenic
1094293419 12:28877273-28877295 AAGGAGATGGAGGAGAAGGAAGG - Intergenic
1094363744 12:29658453-29658475 AATGATCAGGAGAAGAAGGAAGG - Intronic
1094652961 12:32395516-32395538 AAAGATATGGAAAAGTAGAAAGG + Intergenic
1094831591 12:34302745-34302767 AACGATGTGGCAAAGGAGGAGGG + Intergenic
1095586901 12:43859697-43859719 AATGAAATGGAGGGGAAGGAAGG + Intronic
1095611650 12:44135493-44135515 AGTGATATGGGGAAGGGAGAAGG - Intronic
1095828094 12:46551451-46551473 AATGACATGGAGATAGAGCAGGG + Intergenic
1096510089 12:52122893-52122915 AAAGACATGTAGAAGGAGGAAGG - Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1097940257 12:65296886-65296908 AGTGATAGGGAGAAGGAAGTGGG + Intronic
1098011717 12:66060457-66060479 AAAGATAAGGAAGAGGAGGAGGG - Intergenic
1098029983 12:66243529-66243551 ATGGATATTGAGAAGGAGGTGGG - Intronic
1098281313 12:68865491-68865513 AAGAAGATGGAGAAGGATGAGGG - Intronic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098622175 12:72614984-72615006 TATAAATTGGAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1099616430 12:84941516-84941538 AAGGAAAAGGAGAAGGAGAAGGG + Intergenic
1099848247 12:88057520-88057542 GATGATATGGAGTGGGAGAAGGG - Intronic
1100697948 12:97115982-97116004 TATGATATGGAGAAAGAACAAGG + Intergenic
1100874291 12:98945976-98945998 AAGGGGATGGAGAAGGTGGATGG - Intronic
1101353226 12:103952821-103952843 AAAGACATGGAGGAGGATGAGGG + Intronic
1101808504 12:108087011-108087033 GATGAGACAGAGAAGGAGGAAGG - Intergenic
1102230355 12:111257588-111257610 AGTGAGGAGGAGAAGGAGGAGGG - Intronic
1102538833 12:113603289-113603311 AATAATTAGGAGAAGGTGGAAGG - Intergenic
1104277854 12:127346449-127346471 AAACAGATGAAGAAGGAGGAAGG + Intergenic
1104355284 12:128079737-128079759 AATGATGGGGAGCAGGAGGGTGG + Intergenic
1105991142 13:25622369-25622391 AATGATGAGGAGCAGAAGGAAGG + Intronic
1106544030 13:30715053-30715075 ATTGACCTGGAGAAGGAGCAAGG - Intronic
1107026658 13:35808822-35808844 AATGATATGGGGAAGAAATATGG + Intronic
1107137477 13:36959858-36959880 AAGGAAATGGAGATAGAGGATGG + Intronic
1107333973 13:39333728-39333750 GAGGATATGGAGAAATAGGAAGG + Intergenic
1107387551 13:39928428-39928450 AATGAGCTGGGGAAGGAGGAAGG - Intergenic
1107453107 13:40529810-40529832 AAAGAGATAGAGAAGGAGGGAGG + Intergenic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1107877616 13:44804627-44804649 AATGGAATGGATCAGGAGGAAGG - Intergenic
1108128968 13:47276557-47276579 CAAGGCATGGAGAAGGAGGAAGG + Intergenic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108419890 13:50237939-50237961 AATGAGATGTAGAAAGGGGATGG + Intronic
1108565203 13:51689963-51689985 AATTGTATGCAGAAGCAGGATGG + Intronic
1108671199 13:52690807-52690829 AATGGAATGGAGAAAGAGGATGG + Intronic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109764412 13:66874968-66874990 AGAGATATGTAGAAGGGGGAGGG + Intronic
1110413886 13:75231645-75231667 AGTGGTATGGTGCAGGAGGAGGG + Intergenic
1111292692 13:86188413-86188435 AGTGATATGGAAAAGGGGGAAGG + Intergenic
1111456681 13:88493491-88493513 AATTAAATGGAGAAGGCTGAAGG - Intergenic
1111681967 13:91453788-91453810 AAAGAAAGGAAGAAGGAGGAGGG - Intronic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112170277 13:96965869-96965891 AATGAAATCAAGAAAGAGGAGGG - Intergenic
1112221784 13:97498424-97498446 AATAGAAAGGAGAAGGAGGATGG - Intergenic
1112228920 13:97568484-97568506 ACTGATATGGAAAATGAGGCAGG - Intergenic
1112597526 13:100821919-100821941 AATGATATTAATTAGGAGGAAGG - Intergenic
1113427423 13:110220675-110220697 AATGATAGTCAGAAGGAGGACGG - Intronic
1113695047 13:112339379-112339401 AATGATTAGCTGAAGGAGGAAGG + Intergenic
1113697456 13:112356092-112356114 AATGAGATGGCGATGGAGAAAGG - Intergenic
1114245262 14:20906849-20906871 AGTGATATGGAGATGAATGAAGG - Intergenic
1114364242 14:22010019-22010041 GATGAGGAGGAGAAGGAGGAAGG + Intergenic
1114609728 14:24031213-24031235 GAGGATGTGGAGAAGTAGGAAGG + Intergenic
1114657675 14:24325813-24325835 AAGGAGATGGAGAAAGAGGTGGG - Exonic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115344045 14:32323273-32323295 AATCTTATGCAGAAGGAGAAAGG - Intergenic
1115403150 14:32986451-32986473 AAAAGTATGGAGAAGGAGAAAGG + Intronic
1115544437 14:34453006-34453028 AATCATAAGGAGGAGGAGGAGGG - Intronic
1115680000 14:35727776-35727798 AAGGATATGTAGAAACAGGAAGG + Intronic
1116055220 14:39855453-39855475 AGTGATGAGGAGGAGGAGGAAGG - Intergenic
1116663797 14:47748719-47748741 ACTGAGATGGAGGAGGAAGAAGG - Intergenic
1116773260 14:49151399-49151421 AAGCAGCTGGAGAAGGAGGAAGG - Intergenic
1117143884 14:52817223-52817245 AATAATATAGATCAGGAGGAAGG - Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117934122 14:60882270-60882292 ACTGATAGGGAGTAGAAGGAAGG - Intronic
1118115083 14:62766646-62766668 AATTATAGGGAGTAGAAGGATGG + Intronic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119425338 14:74531398-74531420 AGTGATGTGGAGTAGAAGGAAGG + Intronic
1119757873 14:77131550-77131572 AATGGGAGGGAGAGGGAGGAGGG - Exonic
1119961395 14:78860848-78860870 GAAGATATGGAGGAGGTGGAAGG + Intronic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1120255767 14:82117484-82117506 TATGAGAGGGAGATGGAGGAAGG + Intergenic
1121097358 14:91226961-91226983 CATGAAATTGAGAAGGAGGCTGG + Intergenic
1121132197 14:91458587-91458609 AATTCAATGGAGCAGGAGGAGGG - Exonic
1121173490 14:91873254-91873276 AAAGATGAGGAGGAGGAGGATGG + Intronic
1121505172 14:94471821-94471843 AACGATGTGGGGAAGGAGGGTGG - Intronic
1121765730 14:96483884-96483906 AGTGATTTGGGGAATGAGGAGGG - Intronic
1122769652 14:104092312-104092334 AAGCATTTGGAGAAGGAGGTGGG + Intronic
1122837236 14:104436267-104436289 GATGTTATGGAGAAGCAGGACGG + Intergenic
1124992164 15:34685835-34685857 AATAATATGGAGAAGTAGGATGG + Intergenic
1125030999 15:35076026-35076048 ATTGAGATGGAGAAGATGGATGG - Intergenic
1125402385 15:39318010-39318032 AAAGGTAAGGAGGAGGAGGAGGG - Intergenic
1125569635 15:40706394-40706416 AATGATAAAGAGATAGAGGAAGG + Intronic
1125935515 15:43632125-43632147 ATAGCTGTGGAGAAGGAGGAGGG - Intronic
1125948289 15:43728592-43728614 ATAGCTGTGGAGAAGGAGGAGGG - Intergenic
1126925588 15:53582405-53582427 AATGTTTTGGAGAAGGCTGAGGG + Intronic
1127585873 15:60377253-60377275 AATATCAAGGAGAAGGAGGAAGG + Intronic
1128573859 15:68756146-68756168 TATGCTAAGGTGAAGGAGGAAGG + Intergenic
1128797760 15:70477834-70477856 GAGGAGATGGAGGAGGAGGAGGG + Intergenic
1128940584 15:71784762-71784784 ACTGATGTGGAGAAAGAGGTTGG - Intergenic
1129153425 15:73703201-73703223 AATGATAGGGAGAAAGATAACGG + Intronic
1129182356 15:73885285-73885307 ACTGAAGTGGAGAAGGGGGATGG + Intronic
1130090035 15:80813305-80813327 AATGATAACGAGGAGGAGGATGG - Intronic
1130090528 15:80817086-80817108 AAAGCCATGGTGAAGGAGGAAGG + Intronic
1130426077 15:83801440-83801462 CATGAAATGGAAATGGAGGAGGG + Intronic
1130616541 15:85414511-85414533 GATGATATAGAGAATGAAGATGG + Intronic
1130886735 15:88099323-88099345 GATGATTTGGAGAAGGAACATGG + Intronic
1130927481 15:88396426-88396448 AAGGAAGGGGAGAAGGAGGAGGG - Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131152225 15:90054298-90054320 GATGGGATGGAGAAGGCGGAGGG + Intronic
1131802801 15:96089367-96089389 AATGATCTTGGGAAGAAGGAGGG - Intergenic
1132035795 15:98483112-98483134 AATGCTATGAAGAATGTGGATGG - Intronic
1132110472 15:99099061-99099083 TATTATATGGATAAGGAGGTGGG + Intronic
1132189448 15:99838794-99838816 AACAATATGGAGAACCAGGAGGG - Intergenic
1133485421 16:6214732-6214754 AAGGAGAGGGAGAAGGAGAAGGG + Intronic
1133658778 16:7893692-7893714 AATGCTAATGAGAAAGAGGATGG + Intergenic
1134393261 16:13839414-13839436 AATGATATTGAGAGCCAGGAGGG - Intergenic
1135170434 16:20178908-20178930 AAAGACAAGAAGAAGGAGGAGGG - Intergenic
1135259491 16:20968597-20968619 AAAGGAATGGGGAAGGAGGAAGG - Intronic
1135383175 16:22010262-22010284 AAAGATATGAAGAATCAGGATGG + Intronic
1135694693 16:24575754-24575776 AAAGAGAGGGAGAGGGAGGAGGG + Intergenic
1135939591 16:26809742-26809764 AATGCAAGGGAGAAGGAGGAAGG + Intergenic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1137533866 16:49302436-49302458 AAAGCTATGGAAAAGAAGGATGG - Intergenic
1138000019 16:53268529-53268551 ATTTATATGCACAAGGAGGAGGG - Intronic
1138104542 16:54280820-54280842 GATGGTATGGAGAAGCAGGCGGG - Intergenic
1138217369 16:55215950-55215972 AAAGATATGCAGTCGGAGGAAGG - Intergenic
1139010485 16:62626406-62626428 GATGATAAGGAGGAGGACGATGG + Intergenic
1139478644 16:67216045-67216067 AAAGAGCAGGAGAAGGAGGAAGG - Intronic
1139962795 16:70727677-70727699 AGTGCAATGGAGAAGCAGGAGGG + Intronic
1140045691 16:71439180-71439202 AGTGACATGGTGGAGGAGGAGGG + Intergenic
1140329581 16:74041171-74041193 AATGATAGGTAAAAAGAGGATGG - Intergenic
1140713430 16:77699722-77699744 GATGATAAGGAGAAGAAAGAGGG + Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141226547 16:82121632-82121654 AATGATCTGGAGAATTAGGCAGG + Intergenic
1141604434 16:85144862-85144884 ATGGATTTGGAGAAAGAGGAAGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1143129449 17:4667759-4667781 AATAATAGGGTGAAAGAGGATGG - Intergenic
1143164288 17:4890130-4890152 AGCGAGTTGGAGAAGGAGGAAGG - Intronic
1143290752 17:5826119-5826141 AATGATCTGGAGAAGGCGCCTGG - Intronic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1143528693 17:7487803-7487825 AATGAGATGGAGAAGCAAGCAGG - Intronic
1143758871 17:9086867-9086889 GGTGATATTGAGAAGGAGGTGGG - Intronic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144429417 17:15177421-15177443 TGTGATAGGGAGAGGGAGGAAGG - Intergenic
1145882364 17:28361515-28361537 AATGAACTGGAGAAGGCAGATGG - Exonic
1146584405 17:34069802-34069824 AATGATATGAAGACAGAGGGAGG + Intronic
1146586720 17:34089171-34089193 AAATAAATGGAGGAGGAGGATGG - Intronic
1147881567 17:43657561-43657583 AAGGAGATGGCAAAGGAGGAAGG + Intronic
1147943550 17:44066857-44066879 AATGAAAAGGGGAAAGAGGAGGG + Intronic
1149103051 17:52928834-52928856 AATTAGGAGGAGAAGGAGGATGG + Intergenic
1149417852 17:56478947-56478969 AATGATGATGAGGAGGAGGAGGG + Intronic
1149641944 17:58208494-58208516 AATGGTATGGAGAATGAGAGCGG - Exonic
1149750998 17:59145123-59145145 AAGGTTATGGAGATGGATGATGG + Intronic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150052678 17:61980258-61980280 AAGGAAATTGAGAAGGAGGTTGG - Intronic
1150078326 17:62213364-62213386 AAAGAAATAGAGAAAGAGGAAGG - Intergenic
1150789657 17:68193118-68193140 AAGGGTAGGGAAAAGGAGGATGG - Intergenic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150879422 17:69006615-69006637 AATGATTTTTACAAGGAGGAGGG + Intronic
1152476535 17:80522053-80522075 AATGCTCTGGAGAAGGATGGCGG - Intergenic
1153382003 18:4450813-4450835 AATCCTAGGGAGAGGGAGGAAGG + Intronic
1153498144 18:5721315-5721337 AATGAGGTAGAGAGGGAGGAAGG + Intergenic
1153550800 18:6259583-6259605 AAGGAGATGGAGAAGGAGAAAGG - Intronic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1155402780 18:25457370-25457392 AATGACATGCAGAAGGAGCAGGG + Intergenic
1156127351 18:33922015-33922037 AATCATATGGGGAAGATGGAAGG + Intronic
1156398196 18:36717945-36717967 GATGATGAGGAGAAGGGGGATGG + Exonic
1156482660 18:37445881-37445903 GATGATAAGGAGGAGGAGGATGG - Intronic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156620939 18:38850834-38850856 AGTGATGTGGAGAAGGAGGGTGG - Intergenic
1156724485 18:40111696-40111718 AAAGATAGGAAAAAGGAGGAGGG - Intergenic
1156791699 18:40983823-40983845 AAGGAGGTGGAGAAGGAGGAGGG - Intergenic
1157231221 18:45917816-45917838 AATGCTATGGAAAAAGAGAAAGG + Exonic
1157589322 18:48826907-48826929 AATGGAATGGGGAAGGAGGTGGG + Intronic
1157858997 18:51124385-51124407 AATGATATGGAAAAGGGGAAAGG - Intergenic
1157864766 18:51171830-51171852 ATTAATATGGAGCATGAGGATGG - Intergenic
1158275297 18:55760519-55760541 AATGGAAAGAAGAAGGAGGAGGG - Intergenic
1158576862 18:58645500-58645522 AGAGATACGGAGAAGGGGGATGG + Intergenic
1158683778 18:59594221-59594243 ATTCATTTGTAGAAGGAGGACGG - Intronic
1158929390 18:62308021-62308043 AAAGCTATGGATAATGAGGATGG - Intergenic
1159247470 18:65828021-65828043 AACTACGTGGAGAAGGAGGAGGG - Intronic
1159593361 18:70358723-70358745 AAGGAAGTGGAGAAGGAGGCAGG + Intergenic
1160676567 19:394319-394341 AAGGTGATGGAGAAGGATGATGG + Intergenic
1161673089 19:5625065-5625087 AATGAAAAGGAGAAGGAAGAAGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162153807 19:8663467-8663489 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1162153825 19:8663525-8663547 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1162156574 19:8682237-8682259 TATGATCTGGAGGATGAGGATGG + Intergenic
1163211285 19:15842190-15842212 AATGAAATGGGGAAAGACGAAGG - Intergenic
1163353814 19:16796648-16796670 AATGAGAAGGGGAAGAAGGAAGG - Intronic
1163680846 19:18681528-18681550 AATCATATCAAGAAGGAAGATGG + Intergenic
1164196285 19:22965577-22965599 AATTCTAAAGAGAAGGAGGAAGG - Intergenic
1164250274 19:23469629-23469651 GAGGAGATGGAGAAGGAGGGGGG - Intergenic
1164542063 19:29128670-29128692 AAAGACATGGAGGGGGAGGATGG + Intergenic
1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG + Intergenic
1166247561 19:41539869-41539891 AATGATATAGAAAAGGTGAAGGG + Intergenic
1166256678 19:41611142-41611164 TATGAAATGGAGAAGCAGTATGG + Intronic
1166607281 19:44155505-44155527 AATTATAAGGAGGAAGAGGAGGG + Intronic
1166801828 19:45462628-45462650 AATAATACAGAGGAGGAGGAGGG - Intronic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167424677 19:49423882-49423904 AGTCAGATGGAGATGGAGGAGGG + Exonic
1167517698 19:49932801-49932823 GTTGAGGTGGAGAAGGAGGAGGG - Exonic
1168464942 19:56594844-56594866 GAAGAGATGGAGAAGGAGGAGGG - Intergenic
1168657673 19:58142832-58142854 GATGAGAGGGAGAAGGAGAAAGG - Intronic
1168677177 19:58286997-58287019 AATGAAATGGAGAAGATGAAGGG - Intronic
925038650 2:712747-712769 GAAGATATGGAGAAGGAGCTGGG - Intergenic
925156716 2:1653763-1653785 AATCATTTGGAGAACGAGGACGG + Exonic
925825988 2:7849084-7849106 ATTACTATGGAGAAGGATGAAGG - Intergenic
925853346 2:8105650-8105672 AAAGAGAGGGAAAAGGAGGAAGG - Intergenic
926105444 2:10146721-10146743 AAGGGTAGGGAGGAGGAGGAGGG + Intronic
926446466 2:12948511-12948533 TGTGATCTGGAGCAGGAGGAGGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926825421 2:16901390-16901412 AATGATACAGAAGAGGAGGAAGG + Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927705637 2:25294879-25294901 AATGGGAGGGAGGAGGAGGAGGG - Intronic
929237745 2:39624428-39624450 AAGGCAGTGGAGAAGGAGGAGGG + Intergenic
930271262 2:49260301-49260323 ACTGAGATGGAGAACAAGGAAGG + Intergenic
930515264 2:52399755-52399777 AATTAGATCCAGAAGGAGGAAGG - Intergenic
930639481 2:53840509-53840531 AAAGAAAAGGAGAAGGAGAAAGG + Intergenic
930966334 2:57332996-57333018 AAAGATATGTAGAAGGGGTAGGG - Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
932187149 2:69707904-69707926 AGTGATAGAGAGTAGGAGGATGG - Intronic
932301274 2:70668703-70668725 AAAGACATGGAGAAGGAATATGG + Intronic
932369684 2:71176793-71176815 AAAGAAGGGGAGAAGGAGGAAGG - Intergenic
932889549 2:75580067-75580089 AATGATATGGAAGAGGAGGAAGG + Intergenic
933033264 2:77359480-77359502 AATGATCAGGAGATGGAGGAGGG - Intronic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933379520 2:81525124-81525146 AATTATTCTGAGAAGGAGGATGG - Intergenic
933654447 2:84876059-84876081 ACAGATATGGAGAAGGACGGGGG + Intronic
933690838 2:85178474-85178496 AAGGAGCTGGAGAAGGAGCAGGG + Intronic
933995004 2:87661722-87661744 AAAGAAAAGGAGGAGGAGGAGGG + Intergenic
934314736 2:91906842-91906864 GAGGATATGGAGAAATAGGAAGG + Intergenic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
935265754 2:101392453-101392475 AATGACACACAGAAGGAGGAAGG + Intergenic
935465160 2:103388289-103388311 AATGAGCTGGAGAAGCAGGCAGG - Intergenic
936298854 2:111289191-111289213 AAAGAAAAGGAGGAGGAGGAGGG - Intergenic
936401944 2:112171316-112171338 AGTCAAATGGAGAAGGAGGAGGG + Intronic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936838963 2:116746059-116746081 AATGCTATGGAGAGAGAGGATGG + Intergenic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937866558 2:126755995-126756017 AATGATAGGGACCGGGAGGAAGG - Intergenic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938222119 2:129578539-129578561 ATTGCTGCGGAGAAGGAGGAAGG + Intergenic
939259052 2:139783335-139783357 AATGGAATGGAGCAGGAGTAGGG - Intergenic
939434060 2:142150622-142150644 AATGATGAGGAGGAGGAGAAGGG - Intergenic
939539180 2:143472703-143472725 AATGATGAAGAGGAGGAGGAAGG + Intronic
939579727 2:143933705-143933727 AATGTTAGGGATAAAGAGGAAGG - Intergenic
939583221 2:143976329-143976351 AAGGATATGGAGAAGCAATAAGG + Intronic
940121121 2:150267372-150267394 AATGAGACAGAGAGGGAGGAAGG - Intergenic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
940562330 2:155314148-155314170 AATGATCTGGAGAATTAGGCAGG - Intergenic
940568417 2:155399242-155399264 AATGATCAGGAGTAGAAGGAGGG - Intergenic
941466664 2:165836364-165836386 AATGGGATGGAAAAGAAGGAAGG - Intergenic
942588383 2:177511842-177511864 AATGAAAAGGAGATGGAGAAAGG - Intronic
943024878 2:182615796-182615818 AAGGAGAGGGAGAAGGAAGAGGG + Intergenic
943132580 2:183872967-183872989 AAAATTATGTAGAAGGAGGAAGG - Intergenic
943269667 2:185782950-185782972 ATAGATAAGGAGAAGGAGAAAGG - Intronic
943370430 2:187009631-187009653 AATAAAATGAAGAAGGGGGAAGG - Intergenic
943562431 2:189479815-189479837 AATGAAATGAACAATGAGGAAGG - Intergenic
943721384 2:191206574-191206596 AATGATAAGGGAAAGGAGAAGGG - Intergenic
943778058 2:191789208-191789230 AATGATTTGGTAAAGAAGGAAGG + Intergenic
944315244 2:198277733-198277755 CAGGATCTGGAGCAGGAGGAGGG - Intronic
944324036 2:198382555-198382577 AATAACATGGAGCAGGAGGGAGG + Intronic
944447757 2:199808494-199808516 AATGTTCTGGAGATGGATGATGG - Intronic
944647836 2:201797366-201797388 AATTGTATGGAGAAGGAAAATGG + Intronic
945339800 2:208639505-208639527 CCTGATATGGACCAGGAGGAAGG + Intronic
946237390 2:218332541-218332563 GCTGAGATGGGGAAGGAGGAAGG - Intronic
946242433 2:218364865-218364887 AATGATATGGATAAAGCGGAGGG - Intronic
946546337 2:220748667-220748689 ATTTGTATGAAGAAGGAGGAAGG + Intergenic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
947317841 2:228881260-228881282 GAAGCTCTGGAGAAGGAGGAGGG + Intronic
947941896 2:234064129-234064151 AATGAGGGGGAGAAGGAAGAGGG - Intronic
948040475 2:234897493-234897515 AATGAGATAGAGAAGGAGAGGGG + Intergenic
948096212 2:235336060-235336082 AGAGAAAAGGAGAAGGAGGAGGG - Intergenic
948310945 2:236986334-236986356 AATGATATGGAGACAGATGAAGG + Intergenic
948316550 2:237031801-237031823 CATGGTATGGGGAAAGAGGAAGG + Intergenic
948428354 2:237902408-237902430 AAGGACAGGGAGATGGAGGAGGG + Intronic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1168892659 20:1305134-1305156 AATGGCATGGCCAAGGAGGATGG + Exonic
1169565365 20:6847935-6847957 AAGGATGTGGAGAAATAGGAAGG - Intergenic
1170272509 20:14543910-14543932 AATGATATGGACAAGTTTGAGGG - Intronic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1171305174 20:24098972-24098994 AATTTTATGGAGAAAGAAGAAGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172049657 20:32107287-32107309 AATGTTCTGGAGACGGATGACGG + Intergenic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172584404 20:36072397-36072419 AATGAAATGGAGAATAAGGAAGG + Intergenic
1172800545 20:37573439-37573461 AATGAGACAGAGAAGGAGTAGGG + Intergenic
1172926630 20:38542918-38542940 AAGGATATGGAGAGAAAGGAGGG + Intronic
1173034338 20:39394359-39394381 GAAGATATGCAGGAGGAGGAGGG + Intergenic
1173112405 20:40204604-40204626 AAAGAAAGGAAGAAGGAGGAAGG - Intergenic
1173343344 20:42175083-42175105 AAGAACATGGAGAAGGAAGAGGG - Intronic
1173391301 20:42636817-42636839 AATAAAATGGAGATGAAGGATGG + Intronic
1173651813 20:44671175-44671197 AGAGATATGGAGAAGGGGGTGGG - Intergenic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1174173227 20:48629690-48629712 AAGGATATGGTGGGGGAGGAGGG - Intronic
1175111915 20:56654418-56654440 AGTGAGATGGAGAAGGTGAAAGG + Intergenic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1176943355 21:14950698-14950720 GATGCTATGGAGAGGGAAGAGGG - Intergenic
1177149348 21:17438962-17438984 AATGAAATGCAGCTGGAGGATGG - Exonic
1177237869 21:18416563-18416585 AATGATATGGATAAGGTACAAGG - Intronic
1177904868 21:26963383-26963405 AATGTTATGGGGCAGGAGGTAGG + Intronic
1177929033 21:27257177-27257199 AATGATATTGGGAAGAATGAAGG - Intergenic
1178002337 21:28176392-28176414 AATGAAAAGAAGAAGAAGGAAGG + Intergenic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178546084 21:33494013-33494035 ACTGGTATTGGGAAGGAGGATGG - Intergenic
1178745265 21:35243448-35243470 GAGGAGATGGAGAAGGAAGAGGG - Intronic
1178839624 21:36128429-36128451 AGAGATTTGGAGATGGAGGAAGG - Intergenic
1178996004 21:37400417-37400439 AATTATTTGGAAAAGTAGGAAGG + Intronic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1180892159 22:19297112-19297134 AATGCTATGGAAAAGGGGAAGGG - Intergenic
1181923395 22:26338362-26338384 AATGATGGGGAGAAGGCAGAGGG - Intronic
1182460647 22:30481381-30481403 AACCATATGAAGAAGGATGAAGG - Intergenic
1182738376 22:32547443-32547465 AATGAGAAGGAGAAGAAGAATGG - Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1182973012 22:34595292-34595314 AAGGAGATGGGGAAGAAGGAAGG + Intergenic
1183461984 22:37956792-37956814 GATGATGTGGAGGAGGATGAAGG + Exonic
1184449686 22:44575634-44575656 GATGACAAGGAGAAGGGGGATGG + Intergenic
1184482619 22:44756652-44756674 AATGATATGGGGAATAGGGAGGG - Intronic
1184598346 22:45527649-45527671 GATGATTTGGAGTAGGGGGATGG + Intronic
949145566 3:695630-695652 AATGATGTGAAGAATGATGATGG + Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949797158 3:7863833-7863855 AATGCATTGGAGAAGGAAGATGG + Intergenic
950092397 3:10305142-10305164 ACTGTTAGGGAGGAGGAGGACGG - Exonic
950189625 3:10967596-10967618 AATGCTATGGAGAAGGGGTCAGG + Intergenic
950203810 3:11062762-11062784 AATGAGATGGAGAAGGCAGAGGG + Intergenic
950223303 3:11213086-11213108 AATGCTATGGGGAAGAAAGAGGG - Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950283318 3:11725246-11725268 GAAGAAAAGGAGAAGGAGGAGGG - Intergenic
951128625 3:19014351-19014373 AAAGAGATGGAGGAGGAGAATGG - Intergenic
951802822 3:26615380-26615402 AGTTAGAGGGAGAAGGAGGAGGG + Intergenic
951829915 3:26915024-26915046 AATGTGATGGAGAAGGTGGCAGG + Intergenic
952029299 3:29121291-29121313 AATGAGAGAGAGAAGGAGGGAGG + Intergenic
952729971 3:36628453-36628475 AATGATAATGAGGAAGAGGACGG - Intergenic
952814239 3:37433053-37433075 AATTATATACAGAAGAAGGATGG + Intronic
953016299 3:39080099-39080121 AATTATTTGGAGGTGGAGGAGGG + Intronic
953027261 3:39152468-39152490 CAAGATGTGGAGAAGGAAGAGGG + Intronic
953143879 3:40254938-40254960 AATGATAGGGAGGAAGAGGAAGG - Intronic
953554726 3:43935065-43935087 GAGGATATGGAGAAATAGGAAGG - Intergenic
953792898 3:45962075-45962097 AGTGAGATGGAGAAGGAGAGAGG + Intronic
953794729 3:45975874-45975896 AAACATGTGCAGAAGGAGGAAGG + Intronic
953833816 3:46326191-46326213 AAAGATAGTGAGAAGGGGGATGG - Intergenic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954655363 3:52191137-52191159 CCTGATATGGAGAAGGAGCATGG - Intergenic
954783862 3:53079240-53079262 AATGAGAAGGAGGAAGAGGAAGG + Intronic
954973798 3:54674368-54674390 AGTGAGAAGGGGAAGGAGGATGG + Intronic
955425941 3:58790161-58790183 AATAATTAGAAGAAGGAGGAAGG - Intronic
956195186 3:66647371-66647393 AATGAGATGGAAAAGAAGGGAGG + Intergenic
956301425 3:67776235-67776257 AAGGATGTGGAGAAATAGGAAGG - Intergenic
956570728 3:70691377-70691399 GAGGATGTGGAGAAGTAGGAAGG - Intergenic
956621608 3:71226596-71226618 AATGAGATGCAGAAGGGGGTAGG - Intronic
956696373 3:71922404-71922426 AATGAACTGTAGAAGGAGGAAGG + Intergenic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
956957842 3:74361405-74361427 ACTGAGATGAAGAAGCAGGATGG - Intronic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
958114345 3:89196026-89196048 AATGACTGGGAGAAGGAGGAAGG - Intronic
958704482 3:97637182-97637204 AATGATGTGGAGAATGAGTCAGG - Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959627641 3:108471038-108471060 AAAGAAAAGGAGAAAGAGGAAGG + Intronic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
960251436 3:115459946-115459968 AATAAGGTGGAGTAGGAGGAGGG - Intergenic
960415721 3:117383013-117383035 AATGATATGGAAGAGGAGAAGGG + Intergenic
960480282 3:118179633-118179655 AATGAAAAGGAGAAGTAGCATGG - Intergenic
960551666 3:118982659-118982681 AATGATATTAAGGAGGAGGGAGG - Intronic
960659657 3:120043850-120043872 GTTTAGATGGAGAAGGAGGAGGG - Intronic
960851136 3:122055877-122055899 AATGAGATAGAGAAGGTAGAGGG + Intronic
961513211 3:127416499-127416521 AATGAGAAGGGGGAGGAGGAGGG + Intergenic
961951011 3:130749080-130749102 ATTGAGATGGAGAAGAAGGGAGG - Intergenic
962235140 3:133700845-133700867 AAAGAGATGGTGAAGGAAGAAGG - Intergenic
963116575 3:141735424-141735446 AAGGAAAGGGAGAAGGAGAAAGG - Intergenic
963130004 3:141849214-141849236 GCTGATAAGGAGAAGCAGGACGG + Intergenic
963248276 3:143082860-143082882 AAGGAAATGGGGAAGGAAGAAGG - Intergenic
963463242 3:145644398-145644420 AATTATGTGGAGAAGGAGACAGG - Intergenic
963769344 3:149373752-149373774 AATGACATAGAAGAGGAGGAAGG + Intronic
963839860 3:150094192-150094214 AATGATATGTACCACGAGGAAGG - Intergenic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
964036482 3:152205461-152205483 ATTAAAATGGGGAAGGAGGAGGG - Intergenic
964450393 3:156807059-156807081 ACTGATAAGGAAATGGAGGAAGG - Intergenic
964472791 3:157072159-157072181 AAAGAAAAGGAGGAGGAGGAAGG + Intergenic
964494895 3:157278162-157278184 AATGTTATGGAGAAGAAGTTTGG + Intronic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965079537 3:164019668-164019690 AGTGGTAGTGAGAAGGAGGAGGG + Intergenic
965079751 3:164021049-164021071 AAGGATGAGGAGAAGGCGGAGGG + Intergenic
965179445 3:165383245-165383267 GATGAGATGGAAAAGGAGAAAGG + Intergenic
965553378 3:169993747-169993769 AATGAAATGGGGAGGGAGGAGGG - Exonic
965690842 3:171355275-171355297 ATTCATATGGAGCAGGAGGGAGG + Intronic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
966217603 3:177519477-177519499 AATGATATGGAAGAGGGGAAGGG + Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966559173 3:181300003-181300025 AATGAGAAGGAGGAGGAGAAGGG + Intergenic
966668695 3:182502178-182502200 AGGGACTTGGAGAAGGAGGAAGG + Intergenic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
967094581 3:186166658-186166680 AAAGACAGAGAGAAGGAGGAGGG + Intronic
967095516 3:186174392-186174414 AAGGTTATGGAGGAAGAGGAAGG + Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967848608 3:194064681-194064703 GAAGAGATGGAGAAAGAGGAAGG + Intergenic
967931455 3:194693374-194693396 TGTGAACTGGAGAAGGAGGAAGG - Intergenic
970064859 4:12081680-12081702 CAAGACATGGAGAAGGGGGATGG + Intergenic
970260132 4:14215864-14215886 GATGATAAGGAAAATGAGGAAGG + Intergenic
970837000 4:20421173-20421195 AAGGATTTGGTGAAGGATGAGGG + Intronic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
972726288 4:41748658-41748680 ATGGATATGGAGAAGGTGGCTGG + Exonic
974228119 4:59075241-59075263 TATGCTAAGGAGAAGAAGGAAGG + Intergenic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
974517898 4:62940772-62940794 AACAATATTGGGAAGGAGGAGGG - Intergenic
974753773 4:66176784-66176806 AATGAGAAGGAGAAGGAGAAGGG + Intergenic
974975059 4:68881263-68881285 AATGATATGGAAGAGGGGCAGGG - Intergenic
975289147 4:72656643-72656665 GAGGATATGGAGAAATAGGAAGG + Intergenic
976143258 4:82015283-82015305 GAAGAAAAGGAGAAGGAGGAGGG + Intronic
976168748 4:82282411-82282433 AAAAAAATGGAGGAGGAGGAAGG + Intergenic
977146600 4:93448968-93448990 AGGGAGATGGAGAAGAAGGAAGG - Intronic
977484925 4:97632937-97632959 AATTATATTTAGAAGGGGGATGG + Intronic
977632218 4:99255646-99255668 AAGGATGTGGAGAAATAGGAAGG - Intergenic
977696178 4:99969017-99969039 AAATATGTGGAGAAAGAGGAGGG - Intergenic
977811086 4:101356833-101356855 AATGGTATGGGCAAGGATGAAGG - Intergenic
978303393 4:107294970-107294992 AGAGACATGGAGAAGGGGGATGG + Intergenic
978386458 4:108180385-108180407 AAAGAATTGGAGGAGGAGGAAGG + Intergenic
978549516 4:109910370-109910392 AAGGACATAGAGAAGGAGAAGGG - Intergenic
978829250 4:113063886-113063908 AATGAAATAAAGAAGCAGGAAGG - Intronic
979848705 4:125549522-125549544 AAATATTTAGAGAAGGAGGAAGG + Intergenic
980670256 4:135995502-135995524 AATGAGAGAGAGATGGAGGAGGG - Intergenic
980784320 4:137532632-137532654 AAAGAGACGGAGAAGGAGGAAGG + Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
981093645 4:140757078-140757100 AATGGAATGGAGAGGGGGGAGGG - Intergenic
981422617 4:144568674-144568696 ACTGTTATGGAGAAGGAAAATGG - Intergenic
981564893 4:146089900-146089922 GCTGATTTAGAGAAGGAGGAAGG + Intergenic
982088185 4:151857613-151857635 AATGAGATGGAGGAGGGAGATGG - Intergenic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
982117750 4:152112260-152112282 AATGGGGTGGAGGAGGAGGAGGG - Intergenic
982125178 4:152178043-152178065 AGTAATAAGGAGGAGGAGGAAGG + Intergenic
982392640 4:154882316-154882338 AAGGAGATAGGGAAGGAGGAAGG + Intergenic
982551383 4:156804532-156804554 AAAGATTTTGAGAAGGAAGATGG - Intronic
982604591 4:157498362-157498384 TATGGTATGGAAATGGAGGAGGG - Intergenic
983010737 4:162543532-162543554 AATAATATGGAGGAGAAGAATGG + Intergenic
983378245 4:166957465-166957487 AGTGAGATGGAGAAGAATGAAGG - Intronic
983463964 4:168063254-168063276 AAGGATGTGGAGAAAGTGGAAGG + Intergenic
984163780 4:176284595-176284617 TATGATATGGTTAAGGAGAATGG + Intergenic
984981353 4:185284934-185284956 GATGATTTTGAGAAGGATGATGG + Intronic
985814246 5:2114844-2114866 AATGATCTGCAGAGGGAGGCAGG - Intergenic
986043857 5:4019028-4019050 AATTGTCAGGAGAAGGAGGAAGG + Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986237077 5:5921103-5921125 AATATTATTGAGCAGGAGGAGGG + Intergenic
986279239 5:6309969-6309991 AATGAACAGGAGAAGGAGGTGGG - Intergenic
986460080 5:7961149-7961171 AGTGAGATGGAGAAGTAAGAAGG - Intergenic
987009384 5:13746230-13746252 AATGCTGTGGAGAGAGAGGATGG + Intronic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987225471 5:15836017-15836039 AATGTTATTGGGAAGGAGGAGGG - Intronic
987783915 5:22473845-22473867 AATGTTATTGAGAAGGAGACAGG - Intronic
987801433 5:22701778-22701800 AATGTTGTGGAGAACCAGGAAGG - Intronic
988297839 5:29390008-29390030 AAGGTCATGGAGGAGGAGGAGGG - Intergenic
988628885 5:32907758-32907780 GAGGATATGGAGAAACAGGAAGG - Intergenic
989134943 5:38144454-38144476 AAGGAAATAGAGAAAGAGGAAGG - Intergenic
989151317 5:38302387-38302409 AAGGTCATGGAGCAGGAGGATGG - Intronic
989227465 5:39046745-39046767 AAGGATATGGAACAGGAGGAGGG - Intronic
989724774 5:44575101-44575123 AATGACAGAGAGATGGAGGATGG - Intergenic
989764022 5:45057715-45057737 ACTTAAATGGAGGAGGAGGATGG - Intergenic
990120182 5:52442030-52442052 ATTGATATGATGGAGGAGGAGGG - Intergenic
990136174 5:52646026-52646048 AAAGAAAGGGAGAAGGGGGATGG - Intergenic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
990897928 5:60718826-60718848 AAAGAGTTGGAGAAGGTGGAAGG - Intergenic
990904068 5:60784198-60784220 AATGAAATGAAGAAGCTGGAAGG + Intronic
991049611 5:62258571-62258593 AATGATGTGTTTAAGGAGGAAGG + Intergenic
991185097 5:63797077-63797099 AATGAGGAGGAGGAGGAGGATGG + Intergenic
991563954 5:67985254-67985276 GATGAAGTGGAGAAGGTGGAAGG + Intergenic
992697313 5:79302950-79302972 AGTGATGTGGTGAAGGAGGGAGG + Intronic
993463414 5:88214698-88214720 CATGTTATGGGGAAGGAGAAAGG - Intronic
994140011 5:96331870-96331892 AGTGATATGGAGAGGAAAGATGG + Intergenic
994253321 5:97563081-97563103 AGGGATATGGAGAAGGAAGAAGG + Intergenic
994418721 5:99506327-99506349 GATGATATGGAAAAGCAGGAAGG - Intergenic
995074105 5:107961046-107961068 AGTGATACGGAGAAGCAGGCTGG + Intronic
995166543 5:109050632-109050654 AATGATATGGTGCAAGTGGATGG + Intronic
995183045 5:109246731-109246753 AATGAGATGGACAAGGAGAAAGG + Intergenic
995666062 5:114544233-114544255 AATGTTAAGGAGAAGGGGCAGGG + Intergenic
995960274 5:117830336-117830358 AATGTTAAGGAGAAGGGGCAGGG - Intergenic
996504098 5:124249956-124249978 TAAGATATGGAGGAGGAAGATGG - Intergenic
996698656 5:126426201-126426223 AGTGATATGCAGAAGGAATAAGG + Intronic
996828794 5:127716719-127716741 AATCCTATGAAGAAGGAGGTGGG - Intergenic
996950714 5:129121833-129121855 AATAATGAGGAAAAGGAGGAGGG + Intergenic
997682032 5:135763527-135763549 TATTCTATGGAGGAGGAGGAGGG + Intergenic
998244431 5:140485705-140485727 ACTGATCTTGAGAAGGTGGAGGG - Exonic
998394727 5:141811468-141811490 AATGAAAAGGGGAATGAGGAAGG - Intergenic
998458030 5:142288851-142288873 AAGGTTGTGGAGAAGGAGGGAGG - Intergenic
999384630 5:151145472-151145494 AAAGACATGAAGAAGTAGGATGG - Intronic
999473251 5:151874916-151874938 AGTGATAGGGAGCATGAGGAGGG + Intronic
999889373 5:155960145-155960167 AATGAAGAGGAGAAGGAAGATGG - Intronic
1000590858 5:163155792-163155814 AATGATATGAAGAATGGAGAGGG + Intergenic
1000636339 5:163647926-163647948 AAAAAAATGGAAAAGGAGGAAGG - Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001117806 5:168954241-168954263 AATGATATCGGGCTGGAGGAGGG + Intronic
1001763802 5:174228928-174228950 AAGGATATGGAGAAAGAGCCAGG + Intronic
1001791052 5:174458480-174458502 AAGGATGTGGGGAAGGAGGTGGG - Intergenic
1001791089 5:174458576-174458598 AAGGAGATGGGGAAGGAGGTGGG - Intergenic
1001791098 5:174458600-174458622 AAGGAGATGGGGAAGGAGGTGGG - Intergenic
1001791107 5:174458624-174458646 AAGGAGATGGGGAAGGAGGTGGG - Intergenic
1002189103 5:177469669-177469691 AAAGCTAGGGAGGAGGAGGAAGG - Intronic
1002337561 5:178490500-178490522 AATGTTCTGGAGAAGGATGGTGG + Intronic
1002430727 5:179202424-179202446 TAGGAGATGGAGAAGGAAGAAGG - Intronic
1002888513 6:1315668-1315690 AATGAGGTGGGGAAGGAGGGTGG + Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003174416 6:3744527-3744549 AGTGAGATGGGGAAGGTGGAGGG + Intronic
1003182734 6:3806154-3806176 AATGATCTGTAGAAGTAAGAAGG + Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003812993 6:9805229-9805251 AGGGAGATGGAGAAGGGGGAGGG - Intronic
1003904459 6:10686399-10686421 AAGGGAATGGGGAAGGAGGAGGG + Intronic
1004063549 6:12221369-12221391 AATGAAATAGAGTAGGAGAAAGG - Intergenic
1004126738 6:12881576-12881598 GATGAAATGGAGAGGGAAGAGGG - Intronic
1004226532 6:13789811-13789833 AAAGAGATGGAGAAGAGGGAGGG + Exonic
1005429090 6:25735299-25735321 AATGAAATGGAGAATGAGCAAGG + Intergenic
1005475438 6:26203403-26203425 AATGGGAGGGAGAAAGAGGAAGG + Intergenic
1005648294 6:27863459-27863481 ATTAAAATGGAGAAAGAGGAAGG - Intronic
1005969539 6:30750461-30750483 CCTGATATGGAGAGGGAGGGAGG - Intergenic
1006046562 6:31303882-31303904 AATGAGGTGGAAAAGGAGAAAGG + Intronic
1006384290 6:33720801-33720823 AATGATTTGGAGGAAGAAGAAGG + Intergenic
1006548966 6:34804543-34804565 AATGATACTGAGAAGCAGCAGGG + Intronic
1006652434 6:35562808-35562830 AAGGCTCTGGAGAAGGAGAAAGG + Intergenic
1007054967 6:38874112-38874134 AAAGAAAGAGAGAAGGAGGAAGG - Intronic
1007054972 6:38874155-38874177 AAAGAAAGAGAGAAGGAGGAAGG - Intronic
1007646263 6:43383818-43383840 AGTGATGTGGAGAAAGAGGCAGG + Intergenic
1008037889 6:46765234-46765256 TAGGATTTGGAGAAGCAGGAGGG - Intergenic
1008051898 6:46908755-46908777 AAAGAAATGGAGATGTAGGAAGG + Intronic
1008323683 6:50149953-50149975 AATGAGATGTGGAAGGAGAAGGG + Intergenic
1008680125 6:53863252-53863274 AATGCTATGTAAAGGGAGGAGGG - Intronic
1009212892 6:60884219-60884241 GAGGATATGGAGAAATAGGAAGG - Intergenic
1010632356 6:78213191-78213213 AATTAGGTGGAGGAGGAGGAAGG - Intergenic
1011618422 6:89219493-89219515 AATAACAAGGAGAAGGAAGATGG + Intronic
1012301173 6:97590270-97590292 AACTATATGAATAAGGAGGAAGG - Intergenic
1012570497 6:100720546-100720568 AATGATATTTAAAAGGAGGTAGG + Intronic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012800320 6:103819399-103819421 AAAGATCTGGAGAAGCAAGATGG + Intergenic
1013313984 6:108923926-108923948 AATGAGAAGGGGAAGGAGGAGGG - Intronic
1013496681 6:110704818-110704840 AATGAGAGGGAGATGGAGGGAGG + Intronic
1014708108 6:124773290-124773312 AATGGGAAGGAGAAAGAGGAGGG + Intronic
1015027495 6:128554069-128554091 GAAGAGAGGGAGAAGGAGGATGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015284456 6:131469390-131469412 AATAATCTGGAAAAGAAGGAAGG + Intergenic
1016026135 6:139288796-139288818 AATGGCCTGGAGAAGGAAGATGG - Exonic
1016027750 6:139305700-139305722 AATGTTAAGGAGAAGGAAGTGGG + Intergenic
1016097955 6:140061255-140061277 AATAAGATGGAGACAGAGGATGG + Intergenic
1016271368 6:142293961-142293983 GATGTTCTGGAGAAGAAGGAGGG - Intergenic
1016446933 6:144143427-144143449 AAAGATATGGACAGGGTGGAGGG + Intergenic
1016730808 6:147425567-147425589 GAGGATGTGGAGAAGTAGGAAGG - Intergenic
1016733938 6:147455627-147455649 TCTGTTATGGAGGAGGAGGAAGG + Intergenic
1017074993 6:150609754-150609776 AGTGGTACAGAGAAGGAGGATGG + Intronic
1017297204 6:152811910-152811932 AAAGAAAAGGAGGAGGAGGAAGG - Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017858417 6:158372309-158372331 GAGGATCTGGAGAAGAAGGAAGG - Intronic
1018140539 6:160829669-160829691 AATCAAATGGAGAGGGAGAAAGG + Intergenic
1018195867 6:161355930-161355952 ACTGAGATGGAAAGGGAGGAGGG + Intronic
1018330261 6:162719959-162719981 AATAAAATGGAGAAATAGGAAGG - Intronic
1018619417 6:165715549-165715571 AATGAAGGGGAGAAGGAGGAGGG + Intronic
1019930506 7:4219826-4219848 AATGATATGAAGGAGGAGCGGGG - Intronic
1019945372 7:4324541-4324563 GAAGAAAAGGAGAAGGAGGATGG - Intergenic
1021501811 7:21339977-21339999 AAGGATGTGGAGAAATAGGAAGG - Intergenic
1021685159 7:23178255-23178277 AATCATCTTGGGAAGGAGGAAGG - Intergenic
1024228851 7:47348719-47348741 TTTGATCTGGAGAAGGAGGATGG + Intronic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024663903 7:51526857-51526879 GAGGATATGGAGAAAGGGGAAGG + Intergenic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1026465707 7:70652292-70652314 AATCAAATAGAGAAGAAGGAAGG - Intronic
1026604028 7:71800642-71800664 AATGAAATGGAAAATGAGCACGG + Intronic
1027012180 7:74755179-74755201 AGTGATATGGAGAATGACGGTGG - Intronic
1027075860 7:75190875-75190897 AGTGATATGGAGAATGACGGTGG + Intergenic
1027332029 7:77107248-77107270 AATGAGAAGGAGAAGGGGAAGGG - Intergenic
1027464935 7:78503593-78503615 AAGGAGGGGGAGAAGGAGGAGGG - Intronic
1027715732 7:81667768-81667790 AATGTTATGGAGAAGAAAGAAGG + Intergenic
1028307704 7:89286923-89286945 AAAGAAGTGGAGAAGGTGGAAGG - Intronic
1028317474 7:89421441-89421463 AATAAAATAGAGGAGGAGGAAGG + Intergenic
1029090882 7:98047308-98047330 CATGAGAGTGAGAAGGAGGAGGG + Intergenic
1029160832 7:98550645-98550667 CATGGTCTGGAGGAGGAGGAAGG + Intergenic
1029382507 7:100222876-100222898 AGTGAGATGGAGAATCAGGACGG - Intronic
1029783746 7:102764077-102764099 AATGAGAAGGAGAAGGGGAAGGG + Intronic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1030807544 7:113936387-113936409 AAGGAGATGGAGAAGGAAGTTGG - Intronic
1030849877 7:114470797-114470819 AAAAACATGGAGAAGGAGGATGG - Intronic
1030981928 7:116196363-116196385 CAAGATGTGGAGAAGGAAGATGG - Intergenic
1031209787 7:118808363-118808385 AAAGAGATGGAGGAGGTGGAAGG + Intergenic
1031346506 7:120673547-120673569 AATGATATGGAGAAGGAGGATGG - Intronic
1031431555 7:121676796-121676818 AATGATGCAGAGAAGGAGCAGGG - Intergenic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1032408308 7:131673941-131673963 AATGACATGGAAATGAAGGACGG - Intergenic
1032494584 7:132351613-132351635 ATTGTAATGGAGAAGGTGGATGG - Intronic
1032876071 7:136039613-136039635 TATAAAATGGAGAAGGAGGAAGG - Intergenic
1032978342 7:137251685-137251707 AAGGAGGTGGGGAAGGAGGAAGG - Intronic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1033555619 7:142486457-142486479 AAACATTAGGAGAAGGAGGAGGG - Intergenic
1033560465 7:142525985-142526007 AACCATTAGGAGAAGGAGGAGGG - Intergenic
1033889594 7:145994978-145995000 AAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1034397691 7:150839652-150839674 GATGACATGGACAAGGAAGATGG - Intronic
1034696077 7:153055053-153055075 TTGGATATGGTGAAGGAGGAGGG + Intergenic
1034978920 7:155463489-155463511 AAAGAGAAGGAGGAGGAGGAAGG - Exonic
1035009264 7:155698425-155698447 AACCATATGGTGAAGGGGGATGG + Intronic
1035969362 8:4229735-4229757 TATGCTATGTAGAAGCAGGACGG - Intronic
1035979822 8:4357765-4357787 AATGAAAAGAATAAGGAGGATGG + Intronic
1036079452 8:5538799-5538821 ATTGATATGAAGAAGAAAGAAGG + Intergenic
1036135605 8:6158335-6158357 AATGATACGGACAACCAGGAAGG - Intergenic
1036594954 8:10203173-10203195 CATGAATTGGAGAAGGTGGAGGG - Intronic
1036655909 8:10677168-10677190 AATGAAGTGCAGGAGGAGGAGGG - Intronic
1037338586 8:17816467-17816489 GAGGATATGGAGAAATAGGAAGG + Intergenic
1037454708 8:19051993-19052015 AAAGTGATGGAGAATGAGGAAGG + Intronic
1037682020 8:21105441-21105463 AATAATATGGAGAAATAGGCTGG - Intergenic
1038279906 8:26154494-26154516 AAAGTTGTGGAGAAAGAGGAAGG + Intergenic
1038943377 8:32330476-32330498 AAGGATGTGGAGGAGGAAGATGG + Intronic
1039295217 8:36143842-36143864 AATGTTATTGAGATGGGGGAAGG + Intergenic
1039385887 8:37135146-37135168 AAAGAAATCGAGAAGAAGGAAGG + Intergenic
1039424150 8:37471812-37471834 AATGTTTTGGAGAGGGAGTAGGG - Intergenic
1039986530 8:42452453-42452475 GAAGAGATGGAGAAGGAGGAAGG + Intronic
1040079746 8:43274824-43274846 AATGAGAATGAGGAGGAGGAGGG - Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1041273208 8:56129956-56129978 CAGGAGATGGAGAAGAAGGAAGG + Intergenic
1041438235 8:57865031-57865053 AAAGTTCTGGAGAAGGATGATGG - Intergenic
1041539429 8:58966481-58966503 AATGGTATGGAGAGGAAGAATGG + Intronic
1041734599 8:61096380-61096402 AATCATATGGAGAAGAGGGTAGG - Intronic
1042361407 8:67887467-67887489 CAACATATTGAGAAGGAGGATGG - Intergenic
1042846039 8:73170420-73170442 TGTGATATGAGGAAGGAGGAAGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043125608 8:76390623-76390645 AATGATATAGAGAAGTGTGATGG - Intergenic
1043300577 8:78726054-78726076 AATGCTATGGAGAAAAAGCATGG + Intronic
1043704680 8:83333143-83333165 TATGAAATGAAGAAGGAAGAGGG + Intergenic
1044801948 8:95966151-95966173 TAAGAGAGGGAGAAGGAGGAAGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046200940 8:110926913-110926935 AATAATATAGAGAGAGAGGAGGG + Intergenic
1046890516 8:119416588-119416610 CAGGAGATGGAGAAGCAGGAAGG - Exonic
1047001232 8:120574802-120574824 AATGAGATGGAGACCCAGGAAGG + Intronic
1047077917 8:121424894-121424916 ACTGATAGAGAGAAGGAGAAGGG + Intergenic
1047742019 8:127814199-127814221 AAGGGGCTGGAGAAGGAGGATGG - Intergenic
1048083050 8:131149269-131149291 AATGATATGGAGGAGGGGCAGGG - Intergenic
1048769904 8:137884147-137884169 AAGGAAAAGGAGAAGGAGCAGGG - Intergenic
1049044103 8:140136102-140136124 AGTGATTTGGAGAGGGAGGTAGG + Intronic
1049350631 8:142162638-142162660 AGGGAGATGGAGATGGAGGATGG + Intergenic
1049350724 8:142163161-142163183 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350754 8:142163332-142163354 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350784 8:142163468-142163490 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350828 8:142163722-142163744 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350857 8:142163893-142163915 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350898 8:142164081-142164103 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350932 8:142164257-142164279 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049905427 9:212385-212407 AAAGATACGGAGAAAGAGGAAGG + Intergenic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1050412034 9:5376252-5376274 AATGTTCTGGAGATGGAGGGTGG + Intronic
1050443619 9:5694036-5694058 AATTATATGGGGAGGGTGGAGGG - Intronic
1051583979 9:18707144-18707166 AATGATAAGCAGGAGGAGGAGGG + Intronic
1051666978 9:19474823-19474845 ATTGATAAGGAGGAGGAGGAGGG - Intergenic
1052198972 9:25754625-25754647 AATGAACTGGGGATGGAGGAGGG - Intergenic
1052333649 9:27297561-27297583 AGAGATAGTGAGAAGGAGGATGG + Intergenic
1053016954 9:34667314-34667336 AATGAGAGGGAGAAAGAGGGTGG - Intergenic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055577096 9:77671302-77671324 AATGAGCTGGAGAAGAATGAAGG + Intergenic
1055645841 9:78360519-78360541 AATCTGATGGAGAAGGAGAAGGG - Intergenic
1055760946 9:79607003-79607025 GATGATGTGGAGAAATAGGAAGG - Intronic
1056047701 9:82736258-82736280 AATGAGATAGAGACAGAGGAGGG - Intergenic
1057113914 9:92502063-92502085 GATGATGAGGAGAAGGAGTATGG + Intronic
1057214754 9:93221504-93221526 AATCATATGTAGAAGGAGGCAGG - Intronic
1057396046 9:94681449-94681471 GATGAGAAGGAGGAGGAGGATGG - Intergenic
1058256852 9:102777593-102777615 AATGATATGGAGAAGAGACAAGG + Intergenic
1058504681 9:105655979-105656001 AATGTGTTGGAGAAGGAGGTTGG + Intergenic
1058580200 9:106447540-106447562 AAAGAGGTGGAGAAGGTGGAAGG - Intergenic
1058623788 9:106913125-106913147 GATGATGAGGAAAAGGAGGATGG + Intronic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1058936903 9:109778212-109778234 AATGATATGGAGATAGAAGCAGG - Intronic
1058953183 9:109922453-109922475 AAAAAGATGGAAAAGGAGGAAGG + Intronic
1059198052 9:112389352-112389374 TAAGATATAGAGAAGGAGAAAGG + Intronic
1059350461 9:113660643-113660665 GATGAGATGGAAAAGGAGGTAGG + Intergenic
1059628038 9:116089170-116089192 AAAGATATGGAGAAGAAAAAGGG + Intergenic
1060100437 9:120835939-120835961 AATGTTCTGGAGATGGACGATGG - Intronic
1060453124 9:123762473-123762495 AATGGTATGAAGCATGAGGATGG + Intronic
1061717750 9:132531547-132531569 AAGGAGCTGGAGAAGGAGGCAGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062654835 9:137598427-137598449 AAAGATGTGAAGTAGGAGGAAGG + Intergenic
1185688218 X:1948093-1948115 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185688507 X:2133632-2133654 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1186034478 X:5406171-5406193 AAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1186329418 X:8516382-8516404 AAAGATAGGGAGTAGAAGGATGG + Intergenic
1186333132 X:8557687-8557709 GAGGATATGGAGAAATAGGAAGG + Intronic
1186524363 X:10234963-10234985 AATGAGATTGAAAAGGATGAGGG - Exonic
1186720644 X:12300233-12300255 AATGACAAGGAGAAGGACAATGG + Intronic
1187957771 X:24536772-24536794 AATTATATGGTGGAGGAGGGAGG - Intronic
1188089189 X:25941295-25941317 GATGAAATGCAGAAGGTGGATGG + Intergenic
1188267307 X:28093547-28093569 AATCTGATGGAGTAGGAGGAGGG - Intergenic
1188642304 X:32521430-32521452 AATGATAGGGTGGAGGAGGATGG - Intronic
1188822346 X:34790620-34790642 AATGATAGGGATCATGAGGATGG + Intergenic
1189090979 X:38082384-38082406 AATGATCTGTAGAAGAAGAAAGG - Intronic
1189425847 X:40899122-40899144 AATGATATGAAGCATGAGAAAGG + Intergenic
1189919039 X:45885417-45885439 CATGAGATGAAGAAGGAGTATGG + Intergenic
1190713745 X:53087569-53087591 AATGAGAGGGAGATGGAGGGAGG - Intronic
1190938849 X:55020834-55020856 AATGCTATGGAGGGGAAGGATGG - Intronic
1191779554 X:64850712-64850734 AAGGTCATGGAGGAGGAGGAGGG - Intergenic
1193371720 X:80706549-80706571 AAAGATGTGGAGATGGAAGACGG - Intronic
1195261698 X:103138469-103138491 GATGAAATGGGGAAGGGGGAGGG - Intergenic
1195348901 X:103978544-103978566 AATTATAGGAAGAAAGAGGAAGG + Intergenic
1195358542 X:104060295-104060317 AATTATAGGAAGAAAGAGGAAGG - Intergenic
1195397747 X:104429576-104429598 ACAGATATGGAGGAGTAGGATGG - Intergenic
1195973966 X:110505161-110505183 AAGGAAAAGGAGAAGGAGAAGGG - Intergenic
1195990311 X:110675999-110676021 AATTATATGTGGGAGGAGGAGGG - Exonic
1196124222 X:112082347-112082369 AAGGAGAGGGAGAAGGAGGGAGG + Exonic
1196488226 X:116238918-116238940 AATGAGATAGAGAAGGGGAAAGG - Intergenic
1196622438 X:117839085-117839107 AGTGCTGTGGAGAAGGAAGAAGG + Intergenic
1196637270 X:118017047-118017069 GATTATTTGGGGAAGGAGGACGG - Intronic
1196672165 X:118380385-118380407 GATGATATGGGGAAGGTGGTGGG - Intronic
1196817771 X:119678596-119678618 AATGAGAAGGAGAAGCAGAAAGG - Intronic
1197849694 X:130844405-130844427 AAAGAGAAAGAGAAGGAGGAAGG + Intronic
1198133977 X:133728338-133728360 AATGAGAAGGAGAAGGAGAAAGG + Intronic
1198154644 X:133946813-133946835 AATGATGTGAAGAAGGATGCAGG + Intronic
1198167639 X:134072794-134072816 AATGATATGGAAAGGGGGAAGGG - Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198572194 X:137969951-137969973 GATGATAGGGAGAAGGAAGAGGG - Intergenic
1199201361 X:145093791-145093813 AATGATTTGTAGAAACAGGATGG - Intergenic
1199492356 X:148414519-148414541 AAAGATATGGAGATTAAGGAGGG - Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200882024 Y:8224469-8224491 AATGGTATGGAAGAGGAAGATGG + Intergenic
1201632666 Y:16086283-16086305 AAAGTTTTGGAGATGGAGGATGG + Intergenic
1202047280 Y:20747705-20747727 CATGATATGGTGCAGCAGGATGG + Intergenic
1202106018 Y:21366928-21366950 AATGGTATGGAAGAGGAAGATGG + Intergenic