ID: 1031350713

View in Genome Browser
Species Human (GRCh38)
Location 7:120727749-120727771
Sequence CAGGGTGAAAAAGGAGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031350708_1031350713 4 Left 1031350708 7:120727722-120727744 CCATAAACATGAGGTCTGGCAGA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 1031350713 7:120727749-120727771 CAGGGTGAAAAAGGAGCAGAAGG No data
1031350705_1031350713 26 Left 1031350705 7:120727700-120727722 CCGATATGAGGAAGAAAGGGAGC 0: 1
1: 0
2: 4
3: 15
4: 217
Right 1031350713 7:120727749-120727771 CAGGGTGAAAAAGGAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031350713 Original CRISPR CAGGGTGAAAAAGGAGCAGA AGG Intronic
No off target data available for this crispr