ID: 1031353295

View in Genome Browser
Species Human (GRCh38)
Location 7:120761741-120761763
Sequence GGAGGCTATTACAGTGATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031353291_1031353295 7 Left 1031353291 7:120761711-120761733 CCAGAGAAGACTTACAAAGCAAA No data
Right 1031353295 7:120761741-120761763 GGAGGCTATTACAGTGATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031353295 Original CRISPR GGAGGCTATTACAGTGATCT AGG Intergenic
No off target data available for this crispr