ID: 1031357277

View in Genome Browser
Species Human (GRCh38)
Location 7:120802226-120802248
Sequence CACAGGTGATTCCAAAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031357275_1031357277 -1 Left 1031357275 7:120802204-120802226 CCTCGCATTTAGAGTGTGGTTAC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1031357277 7:120802226-120802248 CACAGGTGATTCCAAAGAACAGG No data
1031357272_1031357277 17 Left 1031357272 7:120802186-120802208 CCAAGGCCAAGTCTTACACCTCG 0: 1
1: 0
2: 1
3: 3
4: 64
Right 1031357277 7:120802226-120802248 CACAGGTGATTCCAAAGAACAGG No data
1031357273_1031357277 11 Left 1031357273 7:120802192-120802214 CCAAGTCTTACACCTCGCATTTA 0: 1
1: 0
2: 1
3: 17
4: 58
Right 1031357277 7:120802226-120802248 CACAGGTGATTCCAAAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031357277 Original CRISPR CACAGGTGATTCCAAAGAAC AGG Intronic
No off target data available for this crispr