ID: 1031366385

View in Genome Browser
Species Human (GRCh38)
Location 7:120905239-120905261
Sequence AGGGAGAATCAATATGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031366384_1031366385 -9 Left 1031366384 7:120905225-120905247 CCATGGTCATGGATAGGGAGAAT No data
Right 1031366385 7:120905239-120905261 AGGGAGAATCAATATGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031366385 Original CRISPR AGGGAGAATCAATATGAAAA TGG Intergenic
No off target data available for this crispr