ID: 1031376309

View in Genome Browser
Species Human (GRCh38)
Location 7:121030793-121030815
Sequence TTCAGGCATCCACTTGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031376309 Original CRISPR TTCAGGCATCCACTTGAGGG GGG Intronic
900428658 1:2592004-2592026 CTCTGCCATCCACTTGAGGTAGG + Exonic
901397625 1:8992896-8992918 TTCAGGGTCCCACTTCAGGGAGG - Intergenic
901970752 1:12905804-12905826 GTCAGGGACCCACTTGAGGAGGG - Intronic
902014413 1:13295966-13295988 GTCAGGGACCCACTTGAGGAGGG + Intergenic
904503202 1:30929626-30929648 GTGAGGCATCCTTTTGAGGGAGG - Intergenic
904897309 1:33826576-33826598 ATCAGGCACCCACTTGAGTCAGG - Intronic
908287150 1:62619396-62619418 TTCAGGCATCCACTAGGGGTTGG - Intronic
908858537 1:68456185-68456207 CTCTGACATCCACTAGAGGGGGG - Intergenic
914243805 1:145871522-145871544 TTCTCGCCTCCACTTCAGGGTGG - Intronic
914335312 1:146709651-146709673 TTCAGGTATCCACTGAAGGTTGG + Intergenic
916051568 1:161040077-161040099 TTCAGACATCCACTGGTGAGGGG + Intronic
917703499 1:177605294-177605316 CGCTGGCATCTACTTGAGGGTGG + Intergenic
918460198 1:184768415-184768437 TTCAGGAATCTTCTGGAGGGAGG - Intergenic
918552846 1:185763380-185763402 TGAAAGGATCCACTTGAGGGAGG + Intronic
920869680 1:209783685-209783707 TTCAGCCAGACACTTGAGGAGGG + Exonic
923167139 1:231376581-231376603 TTCAGGCATCCACTTGGTCTCGG + Intronic
924757318 1:246953141-246953163 TTCAGGCCTCCTTTGGAGGGAGG + Intronic
1064791113 10:18958915-18958937 ATCCTGCATCTACTTGAGGGTGG - Intergenic
1064871374 10:19941279-19941301 TTCAGGGATCCATGTGTGGGAGG - Intronic
1066957679 10:42188467-42188489 TTCAGCCGTCCACTTTTGGGTGG - Intergenic
1068161434 10:53270280-53270302 TTCAGGCTTCCACTGGGGGGGGG - Intergenic
1072493638 10:95933857-95933879 GTCAGGGAACCACTTGAGGAGGG + Intronic
1073837769 10:107464227-107464249 GTCAGGGACCCACTTGAGGGAGG - Intergenic
1074027670 10:109653044-109653066 GTCAGGGACCCACTTGAGGAGGG - Intergenic
1077794029 11:5472194-5472216 TTCAGGCACCAACTAGATGGGGG + Intronic
1078627147 11:12968079-12968101 TTCAAGTTTCCACTTGAAGGTGG - Intergenic
1082269033 11:50149523-50149545 TTCAGGGACCCAGTTGAGGAGGG - Intergenic
1082287088 11:50329556-50329578 TTCAGGGACCCACTTGAGGAGGG + Intergenic
1083964493 11:66035079-66035101 CTCAAGCATCAACTTGAGTGGGG + Intergenic
1084627134 11:70316670-70316692 CCCAGGCACCCACGTGAGGGTGG + Intronic
1085120217 11:73962794-73962816 TTCTGGCAGACACGTGAGGGTGG - Intronic
1085809697 11:79668751-79668773 TTCAGGCAGCCCCTTTGGGGAGG + Intergenic
1085884518 11:80506241-80506263 GTCAGGGACCCACTTGAGGAGGG - Intergenic
1086456823 11:86967526-86967548 GTCAGGGACCCACTTGAGGGAGG + Intergenic
1086869032 11:92014991-92015013 TTCAGGGACCTACTTGAGGAGGG + Intergenic
1086901877 11:92376677-92376699 TTCTGGGATCCATTTGAGAGGGG - Intronic
1087432402 11:98070152-98070174 TTGAGGCAGCCAGTTGAGAGAGG - Intergenic
1092925816 12:13271118-13271140 TTCATGAATACACTTTAGGGGGG - Intergenic
1093988407 12:25563589-25563611 GTCAGGGACCCACTTGAGGAGGG + Intronic
1095247810 12:39943230-39943252 ATCAGGGACCCACTTGAGGAAGG + Intronic
1095994871 12:48072857-48072879 TTCAAGCATCCACTGGTGGGGGG + Intronic
1097569691 12:61317415-61317437 GTCAGGGACCCACTTGAGGTGGG - Intergenic
1098586076 12:72155836-72155858 GTCAGGGACCCACTTGAGGAGGG + Intronic
1103945629 12:124524790-124524812 TTCAGGCATTCACCTGGGTGAGG - Intronic
1104365194 12:128170488-128170510 TTCCTGCAACGACTTGAGGGTGG - Intergenic
1105027827 12:132861332-132861354 TACAGGCATCAACCTGAGGCAGG + Intronic
1105231924 13:18504152-18504174 GTCAGGGACCCACTTGAGGAGGG - Intergenic
1106608127 13:31250876-31250898 TTCAGGGACCCACTTCAGGAGGG - Intronic
1106612238 13:31295291-31295313 TTCAGGGACCCACTTGAGGAGGG + Intronic
1107486208 13:40829499-40829521 GTCAGGGACCCACTTGAGGAGGG - Intergenic
1107543978 13:41419775-41419797 TTAATGCATCCTCCTGAGGGTGG - Intergenic
1107968783 13:45621856-45621878 GTCAGGGACCCACTTGAGGAGGG + Intergenic
1108263689 13:48682885-48682907 CACTGGCATCTACTTGAGGGTGG - Intronic
1108695393 13:52898290-52898312 TTTAGGGATGCACTTGAGTGTGG - Intergenic
1109461343 13:62662688-62662710 TGCAGGAGTCCAATTGAGGGAGG + Intergenic
1112228364 13:97563618-97563640 TTCATGCAACCCCATGAGGGAGG + Intergenic
1112745506 13:102522703-102522725 GTCAGGGACCCACTTGAGGAGGG - Intergenic
1113537871 13:111082419-111082441 TGCAGGCATCCACTTGCGGGGGG + Intergenic
1114390525 14:22303249-22303271 GTCAGGCATCCACCTCTGGGTGG - Intergenic
1117310253 14:54514602-54514624 TACTGGGATCCACCTGAGGGTGG - Intronic
1117785317 14:59277923-59277945 TTCAGGCATCCACAGGGGAGGGG - Intronic
1118380167 14:65211644-65211666 TTCAGGTATCCACTGGGGGGGGG + Intergenic
1119423869 14:74523758-74523780 TTCAGGCAAAGACTTCAGGGTGG - Intronic
1119430828 14:74567174-74567196 TTCAGGGCTGCCCTTGAGGGGGG - Intronic
1119691641 14:76677567-76677589 TGCTGGCATCCACTTCTGGGGGG - Intergenic
1121175071 14:91884885-91884907 TTCAGCTTTCCACTGGAGGGTGG - Intronic
1122613995 14:103004299-103004321 GTCAGGAATCCACATAAGGGTGG - Intronic
1122978445 14:105180758-105180780 TTCATGCTACCACTTGAAGGAGG - Intronic
1126371075 15:47947573-47947595 TTGAGGCTTCTACTTAAGGGAGG - Intergenic
1126507164 15:49418628-49418650 TACTGGGGTCCACTTGAGGGTGG + Intronic
1128478626 15:68018546-68018568 TTCAGTCATCTACTTGCAGGTGG + Intergenic
1131602293 15:93861936-93861958 TTCTGGCAACCACTGCAGGGGGG + Intergenic
1132130069 15:99268520-99268542 TTCAGGCATTCACTTTAATGAGG + Intronic
1133147219 16:3797411-3797433 TTCAGGCATCCACTGGGAGTTGG - Intronic
1133781312 16:8941321-8941343 TTCATGCATCCCCTAAAGGGTGG + Intronic
1135672325 16:24385967-24385989 GTTAGGCATACACTTGAGGACGG - Intergenic
1136612009 16:31372056-31372078 TTCAGGCATTCACTGGACAGGGG + Intronic
1137051857 16:35721270-35721292 GTCAGGGATCCATTTGAGGAGGG + Intergenic
1138659970 16:58511138-58511160 CACTGGCATCCTCTTGAGGGAGG + Intronic
1138722375 16:59097101-59097123 GTCAGGGACCCACTTGAGGAGGG - Intergenic
1139998311 16:71001577-71001599 TTCAGGTATCCACTGAAGGTTGG - Intronic
1145017393 17:19408171-19408193 TTCAGGCCTCCAGATGAAGGGGG - Intergenic
1146322286 17:31856488-31856510 TTCAGGCATCCATTGGGGCGGGG + Intronic
1148064240 17:44857089-44857111 TTCAGCAAAGCACTTGAGGGAGG + Exonic
1151278096 17:73051142-73051164 TTCTGGCAGCCACTAGAGGCAGG - Intronic
1151928374 17:77214986-77215008 CTCTCGCATCCACTTCAGGGTGG + Intronic
1152029831 17:77835038-77835060 TCCAGGCCTCCAGTTAAGGGGGG - Intergenic
1152646837 17:81473105-81473127 TGCAGCCATCCACTTGGGGCTGG - Intergenic
1152660323 17:81539084-81539106 TGCTGGCATCCAGCTGAGGGTGG + Intergenic
1153084425 18:1267792-1267814 TTCTGGCTTCCACTTAATGGAGG - Intergenic
1157125867 18:44955302-44955324 TTCAGCCAGCCACTTGAGATGGG + Intronic
1160796868 19:949615-949637 AGCAGGCATCCACTGGAGGGAGG - Intronic
1162864856 19:13538063-13538085 TTCAAGCAGACACTTGAAGGCGG + Intronic
1163108202 19:15140191-15140213 TTAAGGCAGCCCCTTGAGGGTGG - Intergenic
927562488 2:24083944-24083966 CTCAGGCCTCCAGATGAGGGCGG - Intronic
933841034 2:86285742-86285764 TTCAAGCACCCACTTAAAGGGGG - Intronic
934947239 2:98550626-98550648 ACCAGGCAGCCACATGAGGGCGG - Intronic
934960830 2:98671246-98671268 TTCAGTGATCCACTGGAGAGAGG - Intronic
937867800 2:126767090-126767112 TCCAGGGATCCACATCAGGGAGG - Intergenic
939564146 2:143766798-143766820 CTCAGGCATCCACTGGCGGCGGG + Intronic
939586989 2:144017907-144017929 TTTAGCCATCCACTTAAGGCAGG + Intronic
940267382 2:151853263-151853285 TTCAGGCATCCAGATGTGGATGG - Intronic
941518657 2:166511041-166511063 GTCAGGGACCCACTTGAGGGAGG + Intergenic
943512369 2:188841289-188841311 TTAAGGGACCCACTTGAGGAGGG - Intergenic
943561339 2:189466849-189466871 TTCACTCCTCCACTAGAGGGAGG + Intronic
943561365 2:189467095-189467117 TTCAGGCATCAACTGGGGCGGGG - Intronic
944257605 2:197640062-197640084 GTCAGGGACCCACTTGAGGAGGG + Intronic
944262488 2:197692862-197692884 GTCAGGGACCCACTTGAGGAGGG + Intergenic
944661516 2:201925349-201925371 TTCAGTGATTCCCTTGAGGGTGG - Intergenic
947236125 2:227942906-227942928 TTCAGGCATCCACTGGCGACTGG - Intergenic
947311510 2:228808801-228808823 GTCAGGGACCCACTTGAGGAGGG + Intergenic
1174096146 20:48091172-48091194 TTCAGGTACCCACTTGAAGCTGG - Intergenic
1175282356 20:57812469-57812491 TACTGGGACCCACTTGAGGGTGG - Intergenic
1176775898 21:13132453-13132475 GTCAGGGACCCACTTGAGGAGGG - Intergenic
1177184131 21:17775218-17775240 GTCAGGGACCCACTTGAGGAGGG + Intergenic
1178063254 21:28874976-28874998 TGCAGCTATCCACTTTAGGGTGG + Exonic
1178319187 21:31592021-31592043 TTCAGACATTTTCTTGAGGGTGG + Intergenic
1181484857 22:23224197-23224219 TTCAGGCAGCCACTTGGGACAGG - Intronic
1182837039 22:33350610-33350632 TTCAGTCATGCCCTTGGGGGTGG + Intronic
1184604778 22:45566128-45566150 TTCAGGCATCCATTTGTCAGGGG + Intronic
949304917 3:2629085-2629107 TTAAGGCTTCAATTTGAGGGGGG - Intronic
949342563 3:3045326-3045348 GTCAGGGAACCACTTGAGGAGGG - Intronic
950680059 3:14579071-14579093 TTCATCCATCCACTTGTTGGTGG - Intergenic
952863575 3:37835154-37835176 TTCAGGCATCCACTGGTGGGGGG + Intergenic
953884575 3:46708031-46708053 TCCAGGCATACACTTGGAGGAGG - Intronic
953974011 3:47369176-47369198 CTCAGGCATCCAATGGAGAGGGG + Intergenic
955804744 3:62722398-62722420 TTTATGAAGCCACTTGAGGGTGG - Intronic
962361765 3:134748963-134748985 TTCAGGGAACCACTTGCAGGTGG + Intronic
962881936 3:139586546-139586568 TTCTGCCATCCCCTTGAAGGAGG - Intronic
963918887 3:150886938-150886960 TTCAGGCATCCACTGGATAATGG - Intronic
964492173 3:157248788-157248810 TTCATGCAGCCAGTTAAGGGAGG - Intergenic
965251289 3:166347886-166347908 TTCAGCTGTCCACTTTAGGGTGG + Intergenic
968062968 3:195740004-195740026 TTCTGGCAGCCAGGTGAGGGCGG + Intronic
968969278 4:3785065-3785087 TTCTGGAATCCACATGAGTGAGG - Intergenic
969217522 4:5734156-5734178 TTCAGGCATCAAGATGACGGGGG + Intronic
972496141 4:39636709-39636731 TTTAGGCATCCACTGGGGGGGGG - Intronic
972659752 4:41104657-41104679 TACTGGGACCCACTTGAGGGAGG - Intronic
973704226 4:53565316-53565338 GTCAGGGACCCACTTGAGGAGGG - Intronic
974123057 4:57663165-57663187 GACAGGGGTCCACTTGAGGGTGG - Intergenic
976907407 4:90257017-90257039 TTCAGGCATCCACTGCGGGGGGG + Intronic
979038963 4:115762692-115762714 TTCATGCATCCAGTAGAAGGAGG + Intergenic
986687825 5:10289564-10289586 TCCTGGCAGCCCCTTGAGGGAGG - Intronic
988685558 5:33522003-33522025 TTCAGAGAACCACTGGAGGGAGG + Intergenic
989696721 5:44210461-44210483 CACTGGCGTCCACTTGAGGGTGG - Intergenic
990569880 5:57067586-57067608 TTCAGGCATCCACTGGTGAAAGG + Intergenic
992329030 5:75696378-75696400 GTCAGGGACCCACTTGAGGCAGG - Intronic
994355630 5:98791443-98791465 TTAAGACATAAACTTGAGGGTGG + Intronic
995082513 5:108069802-108069824 TTCAGGCATCTGCATGAGGAAGG - Intronic
995287706 5:110410510-110410532 TTCTGCCATCCAATTGAGTGTGG - Intronic
996756133 5:126937178-126937200 TTCAGGCATGAACTTGGTGGTGG - Intronic
998453694 5:142254007-142254029 TCCAGGTTTCCACTTGAGGGAGG + Intergenic
999093083 5:148954803-148954825 ACCAGGCATCCACGTCAGGGTGG + Intronic
1001539597 5:172528135-172528157 ATCAGGCATGGGCTTGAGGGGGG - Intergenic
1003995083 6:11532173-11532195 ATGAGGCACCCACATGAGGGAGG - Intergenic
1006260700 6:32867055-32867077 TTCTGGTTTCCACTTTAGGGAGG - Intergenic
1007268920 6:40620824-40620846 TTCAGGTCCCCACTTGCGGGGGG + Intergenic
1008736664 6:54552941-54552963 CTCTGGGATCTACTTGAGGGTGG + Intergenic
1009485964 6:64221887-64221909 TTCAGGCATCCACTGCGGGACGG + Intronic
1020590082 7:10124466-10124488 TTCAGGCATCCACTGGAGTCTGG - Intergenic
1023909012 7:44540908-44540930 TCCAGGCCTGCAGTTGAGGGAGG - Intronic
1028106937 7:86889411-86889433 TTCAGGCATCCACTGGAGCTGGG - Intronic
1028326782 7:89537700-89537722 TTCAGGCATCAACTTCTGGATGG - Intergenic
1031376309 7:121030793-121030815 TTCAGGCATCCACTTGAGGGGGG + Intronic
1032476210 7:132213162-132213184 TGCAGGGTTCCACTTGTGGGAGG + Intronic
1032991937 7:137403468-137403490 TTCAGGTGTCCTCTTGATGGTGG + Intronic
1033887574 7:145967246-145967268 GTCAGGGACCCACTTGAGGGGGG - Intergenic
1036728415 8:11240704-11240726 TTCAACCATCTGCTTGAGGGAGG - Intergenic
1037261075 8:17009037-17009059 CACAGGCACCTACTTGAGGGTGG + Intergenic
1039038220 8:33382804-33382826 TTCAGGAATCTGCTAGAGGGCGG - Intronic
1040578393 8:48674496-48674518 TTCAGTTATGCACCTGAGGGAGG - Intergenic
1048571772 8:135662758-135662780 TTCTGGCAACCCCTTGAGGTAGG - Intergenic
1049976689 9:866777-866799 TCCAGTCATCCACTTGATGAGGG + Intronic
1049999212 9:1058422-1058444 TACAGGCATGCACTTGAGCCTGG - Intergenic
1051067030 9:13116975-13116997 GTCAGGCATCCACTGGCGGGGGG - Intronic
1051108733 9:13610610-13610632 TTCAGGCATCCTGATGAGGAAGG + Intergenic
1052521964 9:29560249-29560271 TTTACGCATCCACTTGATTGGGG - Intergenic
1059349901 9:113657055-113657077 TGCAGGCATCCAGGTGAGAGGGG + Intergenic
1060930611 9:127487383-127487405 GGCAGGCATCCACTTCCGGGGGG + Intronic
1061264630 9:129497835-129497857 CTCAGGCACCCTCTTCAGGGAGG - Intergenic
1061707370 9:132463493-132463515 TTCAGGTATCCAGGTGGGGGTGG - Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1185985248 X:4825445-4825467 TTCAGGCATCCACTGGGGGTGGG + Intergenic
1187324204 X:18271664-18271686 TTCAGGCATCCACTGGGCAGGGG - Intronic
1187502092 X:19847353-19847375 CTCAGCCAAGCACTTGAGGGAGG - Intronic
1191770359 X:64749839-64749861 TTCAGGGAGCCACTAGAGGAAGG - Intergenic
1193040398 X:76998457-76998479 GTCAGGGATCCACTTGAGGAGGG + Intergenic
1194656934 X:96584638-96584660 GTCAGGGACCCACTTGAGGAGGG - Intergenic
1196028535 X:111069793-111069815 TTCTGGAGTCCACTTGGGGGAGG - Intronic
1196104959 X:111885633-111885655 TTATGGCATCCACTTGAGATAGG + Intronic
1196249687 X:113446120-113446142 GTCAGGGACCCACTTGAGGAGGG - Intergenic
1198158492 X:133985288-133985310 TTCTGGCACCCACTTGAGTCCGG + Exonic