ID: 1031376486

View in Genome Browser
Species Human (GRCh38)
Location 7:121032950-121032972
Sequence CTTTAGATACAGAGGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031376486_1031376491 13 Left 1031376486 7:121032950-121032972 CCCAGCTTCCTCTGTATCTAAAG 0: 1
1: 0
2: 1
3: 39
4: 228
Right 1031376491 7:121032986-121033008 ATCCAAGGAGACCTACCACCTGG No data
1031376486_1031376490 -2 Left 1031376486 7:121032950-121032972 CCCAGCTTCCTCTGTATCTAAAG 0: 1
1: 0
2: 1
3: 39
4: 228
Right 1031376490 7:121032971-121032993 AGCATACACGTTAGGATCCAAGG 0: 1
1: 0
2: 0
3: 2
4: 43
1031376486_1031376489 -10 Left 1031376486 7:121032950-121032972 CCCAGCTTCCTCTGTATCTAAAG 0: 1
1: 0
2: 1
3: 39
4: 228
Right 1031376489 7:121032963-121032985 GTATCTAAAGCATACACGTTAGG 0: 1
1: 0
2: 0
3: 2
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031376486 Original CRISPR CTTTAGATACAGAGGAAGCT GGG (reversed) Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
901447621 1:9317969-9317991 CTGTGGAACCAGAGGAAGCTGGG + Intronic
903510831 1:23873873-23873895 CTGGAAATACAGAGGAGGCTGGG - Exonic
904380291 1:30106242-30106264 CTTTAGAGTCAGCGGAACCTGGG - Intergenic
905465749 1:38151794-38151816 CTATAAAGACGGAGGAAGCTGGG - Intergenic
906328112 1:44861288-44861310 CTTTAGATACAGAGGCTCCTGGG + Intronic
906705060 1:47888673-47888695 CTCTACCTACAGAGGAGGCTAGG - Intronic
906798480 1:48716126-48716148 TTTAAAATACAAAGGAAGCTTGG + Intronic
907071078 1:51535405-51535427 CTTTAAAGACAGAAGAAACTAGG - Intergenic
908654334 1:66371986-66372008 CTTTGGAATCAGATGAAGCTGGG + Intronic
911068859 1:93815957-93815979 CTCTACATACAAAGGATGCTGGG + Intronic
911372190 1:97007162-97007184 CTTTAGATAATGACGGAGCTAGG + Intergenic
912245431 1:107957210-107957232 TTTTAGATACAGAGAAAGAGTGG - Intronic
913306566 1:117433930-117433952 CCTTAGTTGCAGAGGAGGCTTGG + Intronic
919273422 1:195381253-195381275 CTTTATATACACAGAAAGCCAGG + Intergenic
919851482 1:201675955-201675977 CTTTAGGTACAGGGGAAACTGGG - Intronic
920125959 1:203693942-203693964 ACCTAGATACAGAGGACGCTGGG - Intronic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
920540773 1:206776387-206776409 CTTTAGCTGCAGAGGAATCTGGG + Intergenic
921522062 1:216167963-216167985 ATTCAGATAGAGAGGAATCTGGG - Intronic
923566928 1:235083340-235083362 ATTTAGACACAGTGGCAGCTGGG + Intergenic
924150064 1:241120750-241120772 CTCTAGATAGAGAGGAAAATAGG + Intronic
924445622 1:244127784-244127806 CTGGGGATACAGAGGAAGGTGGG - Intergenic
924640303 1:245827230-245827252 CTGTAGAGTCAGAGGGAGCTGGG - Intronic
924648254 1:245900276-245900298 CTTTAGCTATAGAAGAGGCTAGG - Intronic
1062987924 10:1786568-1786590 GTGCAGATGCAGAGGAAGCTGGG + Intergenic
1064933071 10:20649240-20649262 GTTTTGATACAGAGGTACCTGGG - Intergenic
1065199886 10:23302345-23302367 CTTTAGATTCAGGTGAACCTTGG + Intronic
1065765672 10:29027197-29027219 TTTGAGAGACAGAGAAAGCTGGG - Intergenic
1066223792 10:33361550-33361572 CACAAGATAGAGAGGAAGCTTGG - Intergenic
1067720893 10:48727023-48727045 CTTTGGATACTGAAGAAGCCAGG - Intronic
1068076186 10:52257600-52257622 CTTTAGTCACAGAGGATGCAAGG - Intronic
1068361066 10:55975405-55975427 CTTTACTTCCAAAGGAAGCTGGG + Intergenic
1068628501 10:59274938-59274960 CTAGGGATACAGAGAAAGCTGGG + Intronic
1068828122 10:61462564-61462586 CTTTAGCCACAGTGAAAGCTGGG - Intergenic
1073958204 10:108896410-108896432 ACTTAGATATAGAGGTAGCTAGG - Intergenic
1074051833 10:109887462-109887484 CTGTAGAAACAGAGGTAGATGGG - Intronic
1077455713 11:2678728-2678750 CTTGAGTTAGACAGGAAGCTGGG + Intronic
1077853628 11:6099861-6099883 CTGTGGATACAGAGCAAGGTGGG + Intergenic
1079847347 11:25488433-25488455 CTTTACTTCCAGAGGAAGCTGGG - Intergenic
1080687933 11:34530953-34530975 CTTTGGATCCAGAGAAAGATAGG + Intergenic
1080945343 11:36966597-36966619 CTTTAGAAAAAAAGGAAGATAGG + Intergenic
1081829794 11:46098950-46098972 CTTTAGAGACATAGGAATTTGGG - Intronic
1083104558 11:60345597-60345619 CTTTCCTTCCAGAGGAAGCTGGG - Intronic
1083553343 11:63607180-63607202 GTTTAGAGACAGAGTAGGCTGGG + Intronic
1083574395 11:63779230-63779252 CTCTGGCTACAAAGGAAGCTAGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085152757 11:74265346-74265368 CTTCAGACTCTGAGGAAGCTGGG + Intronic
1086135947 11:83444140-83444162 CTTTACTTCCAAAGGAAGCTGGG - Intergenic
1087362320 11:97176603-97176625 CTTTAGAAAAAGAGGAAATTTGG - Intergenic
1088983085 11:114881453-114881475 TTTTAGAGACAGAAGAAGCCAGG - Intergenic
1089953672 11:122551619-122551641 CTTTACTTCCAAAGGAAGCTGGG + Intergenic
1090903054 11:131049328-131049350 CTCCAGGTACAAAGGAAGCTAGG - Intergenic
1091523150 12:1268522-1268544 CTTTAGGAACAGAGGAAGAGGGG + Intronic
1093358790 12:18199615-18199637 CTTTACTTCCAAAGGAAGCTGGG + Intronic
1093707221 12:22287993-22288015 CTTCAGACACTGAGGGAGCTGGG - Intronic
1094826085 12:34270224-34270246 CTTTACTTCCAAAGGAAGCTGGG + Intergenic
1096153159 12:49327204-49327226 CTTTAGGAAGAGAGAAAGCTAGG - Exonic
1097877585 12:64657735-64657757 CTTTTAATCCAGAGGAAGGTTGG + Intronic
1098800013 12:74944310-74944332 ATTTAGAGACAGAGGTAGTTGGG - Intergenic
1103053155 12:117798335-117798357 CTAAAGAAACAGAGGAAGCTGGG + Intronic
1105852452 13:24348035-24348057 CGTTAAATAAAAAGGAAGCTGGG + Intergenic
1107336733 13:39363365-39363387 CTTTAGAGACAGAGGGACCTAGG + Intronic
1107625553 13:42279017-42279039 CATTATATACAGAGGAACCAAGG - Intronic
1107852440 13:44584146-44584168 CTTTAAATACAAAGGAATATTGG - Intergenic
1108476823 13:50828132-50828154 ATCTAGTTTCAGAGGAAGCTAGG - Intronic
1108518439 13:51223348-51223370 CTTTAGAGACAGAGGCTGCCTGG - Intronic
1109878385 13:68436318-68436340 CTTTAGATAGAGAGGAAATGAGG + Intergenic
1110545608 13:76751951-76751973 TTTTGGATACAGAGGGAGGTAGG - Intergenic
1113127296 13:106993618-106993640 CTTTAGAGAGCGAGGAAACTTGG + Intergenic
1115528955 14:34308496-34308518 CTTTAGAAACATAGGAGGTTGGG - Intronic
1116356637 14:43938712-43938734 CTGTAGAGCCAGCGGAAGCTGGG + Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1117661807 14:58014245-58014267 CCTTTGAGACAGAGGGAGCTAGG - Intronic
1118291922 14:64534577-64534599 CTGTAGATACACAGTAGGCTGGG - Intergenic
1118375005 14:65169227-65169249 CTTTAGCCACAGAGGAGGCTGGG - Intergenic
1118833086 14:69453235-69453257 CTTTAGATCCAGAAGCAGCAAGG + Exonic
1119662736 14:76463190-76463212 CTCTAGAGACAGAGGACGCAGGG - Intronic
1121163954 14:91774066-91774088 GTGAAGATCCAGAGGAAGCTAGG + Intronic
1121185984 14:91969877-91969899 CTTTAGATACAGCAGAATCCAGG - Exonic
1121567676 14:94923002-94923024 CTATGGATCCAGAGGGAGCTGGG - Intergenic
1124186304 15:27532483-27532505 CTATAGATAAAGAGGATGCGTGG - Intronic
1125152082 15:36544466-36544488 CTTTGGGTACAAAGGAAGGTGGG + Intergenic
1126844102 15:52743244-52743266 CTTTACTTCCAAAGGAAGCTGGG + Intergenic
1127003690 15:54541109-54541131 CTCTGGATAAAGAGGAAGGTTGG - Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127722258 15:61714841-61714863 CTTTAGATAAATAGGAATATAGG + Intergenic
1128783921 15:70380763-70380785 CTCTGGATGCAGATGAAGCTGGG - Intergenic
1129893884 15:79089923-79089945 CTGGAGATGCAGAGGAAGATGGG - Intronic
1131128174 15:89874091-89874113 CTTAAGCTACAGAGAAAGCCTGG - Intronic
1131324053 15:91425345-91425367 CCTGAGATTCAGACGAAGCTGGG + Intergenic
1132015315 15:98310401-98310423 CTTTAGATATACAGGTAGGTAGG + Intergenic
1132270214 15:100517578-100517600 CCACAGATAAAGAGGAAGCTGGG + Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1133346799 16:5076544-5076566 CTCAAGATGCAGAGAAAGCTCGG - Intronic
1133869246 16:9672508-9672530 CTTTACTTCCAAAGGAAGCTGGG - Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135230831 16:20706377-20706399 CTACAGAAACAAAGGAAGCTAGG + Intronic
1136383597 16:29909082-29909104 CTTTTCACACAGTGGAAGCTAGG - Intronic
1138758790 16:59519058-59519080 CTTTACTTCCAAAGGAAGCTGGG - Intergenic
1138863428 16:60788232-60788254 TTTTAGAGACAGAGGAGGCAGGG + Intergenic
1140067432 16:71623817-71623839 CTATGGATGCAGAGGAAGCCTGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1144412936 17:15019105-15019127 CTTTGGCTACAGAAGAAGATTGG + Intergenic
1144425648 17:15139041-15139063 CTTCAGCTGCAAAGGAAGCTGGG - Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1148707450 17:49648183-49648205 ATTGGGCTACAGAGGAAGCTGGG - Intronic
1148820734 17:50358184-50358206 CTGTAGAGAGAGAGGCAGCTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1154203549 18:12317954-12317976 CTATAAATATTGAGGAAGCTGGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155941848 18:31808092-31808114 CTTTACTTCCAAAGGAAGCTGGG + Intergenic
1158175777 18:54654388-54654410 AATTAGAGACAGAGGAAGATTGG - Intergenic
1158523633 18:58193344-58193366 TTTTAGGTACAAAGGAAGATAGG - Intronic
1159875067 18:73801668-73801690 CTTGAGATTCAGAGGAAATTTGG - Intergenic
1160107973 18:75995766-75995788 TTTTAGAGATAGAGGAAGATTGG - Intergenic
1162924143 19:13921319-13921341 ATTTAGCCACAGAGGAGGCTGGG + Intronic
1163731577 19:18952696-18952718 CGTGAGAGACAGAGGAAGATGGG - Intergenic
925413290 2:3652437-3652459 CCTTAGATACAAAGGAGGCTGGG + Intergenic
927316702 2:21691412-21691434 CTTCAGACACAGGAGAAGCTAGG + Intergenic
929262750 2:39883884-39883906 TTTTAGATGCAGAGGAAGAAGGG + Intergenic
929633515 2:43492015-43492037 TTTAAGATACAGAAGAGGCTGGG + Intronic
931275837 2:60743271-60743293 TATTAGAAACACAGGAAGCTGGG + Intergenic
935187413 2:100746781-100746803 TTTTAGAAACAGAGGAATATGGG + Intergenic
936646471 2:114377850-114377872 CTTTAAATGAAGAGGAGGCTGGG - Intergenic
936965741 2:118126085-118126107 CTTTGGACAGAGAGGCAGCTTGG - Intergenic
937331628 2:121034159-121034181 CATTAGATAGAGAGGTGGCTAGG - Intergenic
938785083 2:134620708-134620730 AATTCAATACAGAGGAAGCTTGG + Intronic
938926299 2:136045963-136045985 CTTTACATACAGAACAGGCTTGG + Intergenic
939908269 2:147946156-147946178 CTATAAATAAAGAGGATGCTGGG - Intronic
940807890 2:158208421-158208443 CTCTAGCTGCAGAGGAGGCTGGG - Intronic
941889480 2:170563877-170563899 CTTTATCTACAGAAGAAGCTGGG + Intronic
943328605 2:186531846-186531868 ATTCAGATTCAGAGGAAGCTAGG - Intergenic
944387750 2:199183664-199183686 CTTTACTTCCAAAGGAAGCTGGG + Intergenic
945376406 2:209082363-209082385 CTTTACTTCCAAAGGAAGCTGGG + Intergenic
945818098 2:214630397-214630419 CTTAAGATGAAGAGGAAGCAAGG + Intergenic
946132956 2:217621877-217621899 CTGTAAATGCAGTGGAAGCTGGG + Intronic
946611696 2:221465571-221465593 CCGTAGATACAAAGGAATCTAGG - Intronic
946729318 2:222692983-222693005 CTTAAGAGGCAGAGGATGCTGGG - Intronic
948351610 2:237345594-237345616 CTTTAGACACGGAGGGAGCCAGG - Intronic
949016948 2:241718951-241718973 CTTTAGATATAAAGGAAGCGTGG + Intronic
1171131360 20:22656711-22656733 CTTTAGAGACTGATGAAGGTTGG + Intergenic
1173136649 20:40444529-40444551 CTTTAGAGAGAGCTGAAGCTAGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1176914191 21:14605085-14605107 CTTCAAATACAGAGGCAGCAAGG + Intronic
1177649343 21:23940383-23940405 CTTTGGCTACAGAGGAGGCCAGG + Intergenic
1177717105 21:24853094-24853116 CTTTGGAGACAGAGGCATCTTGG - Intergenic
1177802890 21:25845724-25845746 ATTTAGATACAGAGAATGATAGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178993310 21:37373755-37373777 GTTTAGATACAAAGGAGTCTGGG + Intronic
1179018131 21:37612423-37612445 TTTAATCTACAGAGGAAGCTGGG - Exonic
1180608519 22:17080145-17080167 CTTTATATGAAGAGGAAGATAGG - Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182609760 22:31537345-31537367 CTTTAGCTACAGAGGAGGTTTGG + Intronic
1183930108 22:41231033-41231055 CTTTAACTACAAAGGAATCTTGG - Exonic
1184123597 22:42471023-42471045 CCTGAGATACAGAGGGAGCTGGG - Intergenic
1185130249 22:49034946-49034968 CTCCAGATCCAGAGCAAGCTCGG + Intergenic
949720695 3:6986719-6986741 GCTTAGATACAGGGGAAGCCAGG - Intronic
949873516 3:8608745-8608767 CTTTAAATCCAGAGGAGGCTTGG - Intergenic
950563520 3:13749767-13749789 CTAGAGATACAGAGGACACTCGG - Intergenic
953074672 3:39557673-39557695 TTCCAGATACAGGGGAAGCTGGG - Intergenic
957304376 3:78438053-78438075 TGTTAGTAACAGAGGAAGCTGGG + Intergenic
959015499 3:101129715-101129737 CTTTTGGTACAGAAAAAGCTTGG + Intergenic
959279755 3:104323313-104323335 CTTTGGTTTGAGAGGAAGCTGGG + Intergenic
960617140 3:119606328-119606350 CTTTATATAAAGAGGAAATTTGG - Intronic
960846572 3:122009368-122009390 CTTTAGATTCAGATACAGCTGGG + Intronic
965440452 3:168706648-168706670 CTCAAAATACAGAGGAAGTTTGG + Intergenic
965678207 3:171222153-171222175 CTTCAGATTCAGAGAGAGCTGGG - Intronic
966067161 3:175832178-175832200 CTTTACTTCCAAAGGAAGCTAGG + Intergenic
967757478 3:193186066-193186088 CTCTAGTTACATAGGTAGCTTGG + Intergenic
970256120 4:14171942-14171964 CTTTACTTACAAAGGAAGCTGGG - Intergenic
970533030 4:17001955-17001977 CTTTACTTCCAAAGGAAGCTGGG + Intergenic
970875067 4:20859689-20859711 CTTAAAATACAGTAGAAGCTTGG + Intronic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974444428 4:61961097-61961119 CTCTAGATACATAGGAGGCCTGG - Intronic
975152415 4:71035660-71035682 CTTTACTTCCAAAGGAAGCTGGG + Intergenic
975474805 4:74811456-74811478 CTTTACATACAAAGGAAGTGAGG - Intergenic
975533435 4:75424331-75424353 CTTAAGAAACAGAGGAAGGCAGG - Intergenic
976390584 4:84500329-84500351 CTTTAGATACAGAAGCATCTAGG + Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
980842031 4:138275334-138275356 ATTGATATACAGATGAAGCTTGG - Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982583485 4:157208413-157208435 ATTTAGACATAGATGAAGCTGGG + Intronic
984322482 4:178211376-178211398 CTTTACTTCCAAAGGAAGCTGGG + Intergenic
984759813 4:183353904-183353926 CTTTGGAAACTGGGGAAGCTGGG - Intergenic
986785959 5:11114033-11114055 TTTTTGATGCAGAGGATGCTTGG - Intronic
987731242 5:21775371-21775393 CTTTGGATCCATAGTAAGCTGGG + Intronic
987884687 5:23798896-23798918 CATTAGATCCAAGGGAAGCTGGG + Intergenic
988150260 5:27368270-27368292 CTGTAAATACGGAGGGAGCTTGG + Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
990032507 5:51278694-51278716 CTGTAGAGACAGAGAGAGCTTGG + Intergenic
992624269 5:78622784-78622806 CTTTAGATTCAGGGTGAGCTGGG + Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994778657 5:104065618-104065640 CTTTACTTCCAAAGGAAGCTGGG - Intergenic
994991789 5:107006016-107006038 CTTTAGATTGAGTGGAAACTTGG - Intergenic
997716170 5:136044563-136044585 GTTTAGACACAGAGGGAGATGGG - Intronic
998576056 5:143317944-143317966 CTTTACATACAGACAAATCTGGG + Intronic
999866406 5:155705147-155705169 CTTTAGCTACAAAGGAGGCTGGG - Intergenic
1000640394 5:163695690-163695712 CTTCAAATACAGAGAAAGCCAGG - Intergenic
1001152247 5:169242264-169242286 CATTAGAAACACAGGCAGCTGGG - Intronic
1001585685 5:172832658-172832680 ATCTAGCTACAAAGGAAGCTGGG + Intergenic
1002446019 5:179290548-179290570 CGTTGCATACGGAGGAAGCTGGG + Intronic
1003964329 6:11238704-11238726 CCAGAGATACAGAGGAAGATTGG - Intronic
1004765173 6:18718278-18718300 CTTTAGATGCAGATAAAGCTTGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005094458 6:22098889-22098911 CTTTACATAAACAGGAAACTAGG - Intergenic
1007121587 6:39386712-39386734 TTTTAGAGACGGAGGAAGCCTGG - Intronic
1009660862 6:66609392-66609414 ATTTTGAAACAGAGGAAGCAAGG - Intergenic
1011309016 6:85960716-85960738 CTCTAGAAACAAAGGAACCTGGG + Intergenic
1011602346 6:89071259-89071281 CTTTAGGTAAACAGCAAGCTAGG + Intergenic
1012350710 6:98246689-98246711 CTCTAGATTCAGATGAAACTTGG + Intergenic
1012675393 6:102106241-102106263 CTTTACTTCCAAAGGAAGCTGGG + Intergenic
1014435647 6:121418166-121418188 CTTTGGAGACAGAGGCAGGTGGG + Intergenic
1015516487 6:134087673-134087695 CTTTAGATACTGAGAAAACTAGG + Intergenic
1015801059 6:137062555-137062577 CTTTACTTCCAAAGGAAGCTAGG - Intergenic
1016403758 6:143708636-143708658 CTTTAGATACCCAGGACACTGGG - Intronic
1017063846 6:150510305-150510327 CTTTACAAGCAGAGGGAGCTGGG + Intergenic
1019851690 7:3565280-3565302 CCTTAGCTACAAAGGAATCTGGG + Intronic
1019918889 7:4150430-4150452 TCTGAGAGACAGAGGAAGCTCGG - Intronic
1019960466 7:4455211-4455233 CTTGAGTTGCAAAGGAAGCTGGG - Intergenic
1020540804 7:9459757-9459779 CTTTACTTCCAAAGGAAGCTGGG - Intergenic
1021103244 7:16607820-16607842 CTTCTGTTACTGAGGAAGCTGGG - Intronic
1022107200 7:27205104-27205126 CGTTAGAAGCAGAGGGAGCTTGG + Intergenic
1022960937 7:35425933-35425955 CTTGAGTAACAGAGGCAGCTGGG - Intergenic
1023115616 7:36859122-36859144 CTGTAGATTCAGAGAAACCTAGG + Intronic
1025985779 7:66450276-66450298 CTTCAGATACAGAGAAATCTTGG - Intergenic
1026029224 7:66775165-66775187 CTTCACATACAGAGAAACCTTGG + Intronic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1027209005 7:76128822-76128844 CTTCAGATACAGAGAAATCTTGG - Intergenic
1028814483 7:95129020-95129042 TTTTATATACAGTGAAAGCTAGG + Intronic
1030844770 7:114395532-114395554 TTTTAGATAAAGAGAAAGCAAGG + Intronic
1031376486 7:121032950-121032972 CTTTAGATACAGAGGAAGCTGGG - Intronic
1031777669 7:125922074-125922096 CTTTACTTCCAAAGGAAGCTGGG + Intergenic
1032510138 7:132465887-132465909 TTTTAGAAAAAGAGGAGGCTAGG + Intronic
1032901257 7:136311249-136311271 CTTTAGATCCAGAGGAATTCTGG + Intergenic
1033236359 7:139640909-139640931 CTTTAAAAAATGAGGAAGCTGGG - Intronic
1037421457 8:18707727-18707749 CATTAGAAACATAGTAAGCTAGG + Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1041530476 8:58860176-58860198 CATTAGAAACAGTGGCAGCTAGG - Intronic
1041566802 8:59287529-59287551 AATTAGATGCACAGGAAGCTGGG + Intergenic
1042230955 8:66553996-66554018 CTTTATATACAAATGAAACTAGG + Intergenic
1042437490 8:68784185-68784207 CTTTAAACACAGGGAAAGCTTGG - Intronic
1043717616 8:83506638-83506660 CTTTACTTCCAAAGGAAGCTGGG - Intergenic
1043806977 8:84683845-84683867 CTTAATATACAGAATAAGCTGGG - Intronic
1052432284 9:28381994-28382016 CTTTGGATACAGATGGACCTAGG + Intronic
1053525883 9:38830122-38830144 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054198114 9:62054547-62054569 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054640240 9:67533816-67533838 CTTTAAAAACAGAAGAATCTGGG - Intergenic
1056286608 9:85093474-85093496 CTTTACATAGAGAGGCAGTTGGG + Intergenic
1056300278 9:85233114-85233136 ATTTAGAAACAGAGTATGCTAGG - Intergenic
1058430365 9:104913294-104913316 TTTTAGAGTCAGAGAAAGCTGGG + Intronic
1058952661 9:109917880-109917902 CTTTATCTTCAGTGGAAGCTAGG + Intronic
1059327787 9:113514782-113514804 CTTTAGATGCATAGGATTCTAGG + Intronic
1059406801 9:114104362-114104384 CTTTAGTTACAGAGAAAGTTAGG - Intergenic
1062125204 9:134856507-134856529 TTTTAGTGTCAGAGGAAGCTTGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186835166 X:13430326-13430348 CTCTAGACACAGGGGAAGCTGGG + Intergenic
1187215921 X:17276212-17276234 CACTAGATACAAAGAAAGCTTGG + Intergenic
1187529048 X:20080088-20080110 TTGTAGAAACACAGGAAGCTAGG - Intronic
1191761640 X:64653568-64653590 CTTTACTTACAAAGGAAGCTGGG + Intergenic
1193997466 X:88384243-88384265 CGTGAGACACAGAGGAAGATTGG - Intergenic
1198772066 X:140140965-140140987 TTCTAGATTCAGAGGAATCTGGG + Intergenic
1200078768 X:153565334-153565356 CTTTAGCTACAGGGGATGCCTGG - Intronic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic
1202076194 Y:21040134-21040156 CTTTACTTCCAAAGGAAGCTGGG - Intergenic