ID: 1031380030

View in Genome Browser
Species Human (GRCh38)
Location 7:121074292-121074314
Sequence CTGGACAAGAGCCCCTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031380030_1031380035 10 Left 1031380030 7:121074292-121074314 CCAGAAAAGGGGCTCTTGTCCAG 0: 1
1: 0
2: 4
3: 14
4: 164
Right 1031380035 7:121074325-121074347 ATAGCCAAAAGACTGGCAGCTGG 0: 2
1: 4
2: 38
3: 90
4: 231
1031380030_1031380034 3 Left 1031380030 7:121074292-121074314 CCAGAAAAGGGGCTCTTGTCCAG 0: 1
1: 0
2: 4
3: 14
4: 164
Right 1031380034 7:121074318-121074340 TTGTTGTATAGCCAAAAGACTGG 0: 1
1: 3
2: 40
3: 92
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031380030 Original CRISPR CTGGACAAGAGCCCCTTTTC TGG (reversed) Intronic
902296597 1:15471766-15471788 CTGGCTAAGACCCCCTTTACAGG + Intronic
902299396 1:15491067-15491089 CTGGCTAAGACCCCCTTTACAGG + Intronic
903588785 1:24438479-24438501 CTGGCCAACTGCCCCTTCTCAGG + Intronic
904807206 1:33140519-33140541 GGGGGCAAGAGCCTCTTTTCTGG + Intergenic
905404910 1:37726089-37726111 CAAGCCAAGAGCCCCTCTTCCGG - Intronic
907355463 1:53869567-53869589 CTGGATAAGAGCACCAGTTCTGG - Intronic
907523149 1:55038231-55038253 CTGGACAGCAGCCCCCTTCCTGG + Intergenic
907927049 1:58964852-58964874 CAGGACTGGAGCCCCTATTCAGG + Intergenic
911870632 1:103093647-103093669 TTGGACAAGAACCCTTTTTCTGG + Intronic
912223738 1:107707547-107707569 CTGGTAAAGAGTCCCTTTTTAGG + Intronic
912548095 1:110465694-110465716 CTGCACCAGAGCCTCTTCTCAGG - Intergenic
912802616 1:112729966-112729988 CTGGAGAAAAGCCCCTATTCTGG - Intergenic
915405120 1:155654238-155654260 CTGGGGAAGTGCCCCTTCTCCGG + Intergenic
915851981 1:159333989-159334011 CTGGATGAGAACCCTTTTTCTGG - Intergenic
916188045 1:162152198-162152220 CTGGGCAGCAGCCCCTTTCCTGG + Intronic
919579235 1:199350508-199350530 CAGGACAAGAGCCCTTTTTATGG + Intergenic
920072210 1:203310420-203310442 GATGACAAGAGCACCTTTTCTGG - Intergenic
921373111 1:214445969-214445991 CTGCTCAAGAGTCCCTTTGCTGG + Intronic
923099747 1:230802896-230802918 CAGGACAAGAGCCCTCTCTCAGG + Intergenic
923144569 1:231188940-231188962 CTCCACAAGATCCACTTTTCTGG + Intronic
1064301569 10:14127476-14127498 CTGGAGAAGAGGCCCTTTAAGGG + Intronic
1064739648 10:18419601-18419623 CTGGACAAGACCCCTTTTCCAGG - Intronic
1066422542 10:35276105-35276127 CTGGACCCGAGCCTATTTTCAGG - Intronic
1071014126 10:80974674-80974696 CTGGACAAGAACACTTTTTATGG - Intergenic
1072784687 10:98271721-98271743 CTGAACAAAAGCCCTGTTTCTGG - Intergenic
1075378270 10:121997204-121997226 CTCAACAAATGCCCCTTTTCGGG - Intronic
1076718591 10:132382029-132382051 CTGGACAAGAACCTCTTTTCTGG + Intergenic
1077476552 11:2793024-2793046 CTGGACAAGCATCCCTTTGCGGG - Intronic
1077951834 11:6967677-6967699 CTGGATATTAGCCCTTTTTCAGG + Intronic
1079104531 11:17561745-17561767 CTGGCCAAGAGCCGCTCTTCGGG + Exonic
1085409494 11:76282842-76282864 CTGGCCCAGAGCCCGTTTTAGGG - Intergenic
1089622555 11:119729943-119729965 CTGGAGGAGAGCTCGTTTTCAGG - Intergenic
1091167382 11:133491707-133491729 ATAGACCAGAACCCCTTTTCTGG + Intronic
1092263683 12:6965507-6965529 CTGAAGACTAGCCCCTTTTCTGG - Exonic
1095432286 12:42146530-42146552 CTGCATCAGAGCCCCTTGTCTGG - Intergenic
1098722147 12:73913777-73913799 ATTGACAAGAGCCACTTCTCAGG + Intergenic
1099418114 12:82419416-82419438 CTGGACAAGAACCCTTTTTCTGG + Intronic
1100642731 12:96498159-96498181 CTGGATCAAAACCCCTTTTCTGG + Intronic
1101472018 12:105006554-105006576 TTGGACAAGACCCCTTTGTCTGG - Intronic
1105962242 13:25352736-25352758 CTGGACCAAGACCCCTTTTCTGG - Intergenic
1107825549 13:44325871-44325893 CTGGAGTAGAGACCCTTTTATGG - Intergenic
1111136563 13:84053412-84053434 CTGAACAAGAGCTCCTGTTGAGG - Intergenic
1113402890 13:110011028-110011050 CTGGACCAGAGTCTCCTTTCTGG - Intergenic
1114063910 14:19043910-19043932 CTGGAGAAGAGGCCCTTTAACGG + Intergenic
1114098348 14:19356086-19356108 CTGGAGAAGAGGCCCTTTAACGG - Intergenic
1114551965 14:23537884-23537906 CTGGGCAAGAGGCCCTGTCCTGG + Intronic
1116520192 14:45837088-45837110 CGGGACAAGAACTCTTTTTCTGG - Intergenic
1117353630 14:54903077-54903099 CTGGACGACTGCCTCTTTTCGGG - Intergenic
1118683735 14:68269868-68269890 CTGGACAACAGCCCTTTTCATGG - Intronic
1121443801 14:93965991-93966013 CAGGGCAAGTGCCCCTCTTCTGG + Intronic
1125260690 15:37821438-37821460 CTGGTCAAGAGCCCGTTATCGGG - Intergenic
1125411782 15:39414036-39414058 ATGGAGAAGAGCCCCAATTCTGG + Intergenic
1128461692 15:67873688-67873710 CTGGAGAAGCTGCCCTTTTCAGG - Intergenic
1130433774 15:83875387-83875409 CTGGCCAACAGCCCCAGTTCTGG - Intronic
1133926074 16:10193588-10193610 CAGGACAAAAGCCTGTTTTCTGG + Intergenic
1137793231 16:51192953-51192975 CTGGTCCAGATCCCCTTTGCTGG + Intergenic
1139568995 16:67798767-67798789 CTGGCCAAGAGCCCTTGTCCAGG - Intronic
1140195492 16:72851361-72851383 CTGATGAAGAGCCCCTTGTCGGG - Intronic
1140802302 16:78499581-78499603 CTGGCCCAGGGCCCCTTTGCCGG + Intronic
1142695733 17:1632094-1632116 CTGGCCATTTGCCCCTTTTCAGG - Intergenic
1142980415 17:3668188-3668210 CTGGAAAAGCGCCCCCTTCCCGG - Intronic
1146790709 17:35749058-35749080 CTGGGCAAGAAACCCTATTCTGG + Intronic
1148908578 17:50927372-50927394 CTGGGCCAGACCCCCATTTCGGG - Intergenic
1149525595 17:57353132-57353154 CTGGAGGAGAGCGCATTTTCGGG - Intronic
1149705579 17:58691852-58691874 CTACACAAGAGCTCCTTTTGTGG - Intronic
1151217653 17:72588798-72588820 CAGGAGAAGGGCCCCTTTCCTGG + Intergenic
1152322513 17:79615854-79615876 CTTTACAAGAGCCTCTTTTAGGG - Intergenic
1153116684 18:1665588-1665610 CGGGACAACAGCCCATTTTCCGG - Intergenic
1153804523 18:8700864-8700886 CTGGACATGAAGCCTTTTTCAGG + Intergenic
1157984604 18:52422854-52422876 TTGGTCAACAGCCACTTTTCTGG + Intronic
1158538911 18:58334883-58334905 CTTGATAAGAGCGTCTTTTCTGG + Intronic
1160111001 18:76030849-76030871 TTGGAATAGAGCCCCTTTTCAGG - Intergenic
1163813039 19:19446423-19446445 CTGGACACTAGACCCTTATCAGG + Intronic
1166319518 19:42007711-42007733 CTGGACAAGAGCAACTTTCAAGG + Intronic
1168467638 19:56616985-56617007 TTGGACAAAAGCCCCATTTGGGG + Intronic
926530009 2:14032573-14032595 CTGAACAAGTGCTCCTTTTTTGG + Intergenic
927712847 2:25336393-25336415 GTGGAGAAGGGTCCCTTTTCTGG - Intronic
927994312 2:27472265-27472287 CTGGACACAAGCTCCTCTTCAGG - Exonic
930556812 2:52906722-52906744 CTGGACATTAGCCCTTTGTCAGG + Intergenic
930748918 2:54913539-54913561 CTGGATATTAGACCCTTTTCAGG + Intronic
931596468 2:63950555-63950577 CTGGATGAGAACCCTTTTTCTGG - Intronic
936865695 2:117074146-117074168 CTGGGTAAGAGCCCCTATTGTGG - Intergenic
937162227 2:119775328-119775350 CTGGACAATAACTCTTTTTCTGG + Intronic
938481174 2:131662887-131662909 CTGGAGAAGAGGCCCTTTAATGG + Intergenic
940489398 2:154338614-154338636 GTGGGCAAGAGCCCCTATTGTGG + Intronic
940756045 2:157684467-157684489 CTGGAGAACATCCCCTTTTACGG + Intergenic
942489771 2:176477512-176477534 CTGGACAACACACCCTTCTCTGG + Intergenic
947492654 2:230609220-230609242 CTGGATATGAGCCCTTTGTCAGG - Intergenic
947891227 2:233622616-233622638 CTGGATATGAGCCCTTTGTCAGG + Intronic
1169679878 20:8199179-8199201 CTGGACAGTAGCCCCTTCTGTGG + Intronic
1170097000 20:12656978-12657000 CTGGTCAAGAGCACATTGTCTGG - Intergenic
1173183434 20:40821322-40821344 ATGGACAAGAGCCCCATTCCTGG + Intergenic
1173998364 20:47357108-47357130 CTGGACAAGGGCCGTTTCTCTGG - Intergenic
1174392576 20:50226936-50226958 CTGGTCCAGGGCCCCTTGTCTGG + Intergenic
1175529032 20:59661543-59661565 ATGGACAGGACCCCCTTTTTAGG + Intronic
1175853678 20:62107408-62107430 CTTCCCAGGAGCCCCTTTTCTGG - Intergenic
1176658624 21:9613091-9613113 CTGGATAACAGCCCCTGCTCTGG + Intergenic
1177962892 21:27690669-27690691 CTGGCCACTAGCCCCTTTCCTGG - Intergenic
1178741401 21:35205451-35205473 CTGGGCAAGAGGCCATTGTCGGG + Intronic
1179989838 21:44941953-44941975 CTGGGCAAGAGCTCCGTGTCAGG + Intronic
1180482402 22:15766543-15766565 CTGGAGAAGAGGCCCTTTAACGG + Intergenic
1181435676 22:22909247-22909269 CTGGCCAAGAACCAATTTTCAGG - Intergenic
1183485075 22:38084204-38084226 CTGGACAAAAGCCTCTTAGCAGG - Intergenic
950373397 3:12550229-12550251 CTGAACAATAGTCCCTTGTCTGG - Intronic
950375107 3:12564970-12564992 CTGGATAAGAGCCCATTGTATGG + Intronic
951875098 3:27415300-27415322 CTGGATGAGAGCCCTTTTTCTGG - Intronic
952966105 3:38622300-38622322 CTGGACACAAGCCCCCTTCCAGG + Intronic
955168918 3:56543890-56543912 CTGGATATTAGCCCTTTTTCCGG - Intergenic
965352885 3:167636883-167636905 CTGGACATTAGCCCTTTGTCAGG + Intronic
965635194 3:170773594-170773616 CAGGACAAGTTTCCCTTTTCTGG + Intronic
967115051 3:186329678-186329700 CTTGACAAGTGCCCCATCTCTGG + Intronic
968658271 4:1787869-1787891 CTCGGCCAGAGCCCCTTCTCAGG - Intergenic
969211838 4:5693698-5693720 ATGGCCAAGAGCCCTTTTTTGGG - Intronic
969363951 4:6683080-6683102 CAGGACAGGGGCCCCTTTCCTGG - Intergenic
969944174 4:10765737-10765759 CTTGACTAATGCCCCTTTTCTGG - Intergenic
971120696 4:23701334-23701356 CCAGACAAGCACCCCTTTTCTGG - Intergenic
971764441 4:30811553-30811575 CTGGGCAGGACTCCCTTTTCAGG + Intronic
974874951 4:67692541-67692563 CTGGACAAGAACCCTTTTTCTGG + Intronic
975203721 4:71621039-71621061 CTGGATATTAGCCCCTTGTCAGG - Intergenic
976313843 4:83638437-83638459 CTGGACAAGAACCCTGTTTAGGG + Intergenic
976627255 4:87199604-87199626 CTGGATATTAACCCCTTTTCAGG - Intronic
978209221 4:106114851-106114873 CTGGTCAAGAACCCCTAGTCTGG - Intronic
979670230 4:123353686-123353708 ATGGTCAAGAGTCCCATTTCTGG + Intergenic
979863714 4:125726244-125726266 CTGGACAAGAACCATTTTTCTGG - Intergenic
980120727 4:128725288-128725310 CTAGACAAATGCCCCTTTTGGGG + Intergenic
984769407 4:183424343-183424365 CTGGCCAAGAGCCTCTATTGTGG + Intergenic
985416782 4:189742976-189742998 CTGGATAACAGCCCCTGCTCTGG - Intergenic
992627751 5:78649538-78649560 CTGGACAAGAATGCCTTTTCAGG - Intronic
994438211 5:99764848-99764870 CTAGACAAGTGCCCATTTGCAGG + Intergenic
995789095 5:115864221-115864243 GTGGATGAGAACCCCTTTTCTGG + Intronic
996981839 5:129506027-129506049 CTGCACAAGTGCCCCTGTGCTGG - Intronic
997136054 5:131327609-131327631 CAGGTCAAGAGTCCCTTTCCTGG + Intronic
997528906 5:134570330-134570352 CTGGAAAAGAGCCCCTGTGGGGG - Intronic
998886571 5:146700852-146700874 CTGTAAAAGAGAGCCTTTTCTGG - Intronic
1000884562 5:166736491-166736513 CTGGCCAAGAACCCCTTTAGTGG - Intergenic
1001321938 5:170689831-170689853 CAGGCCAGGAGCCCCCTTTCTGG + Intronic
1001587461 5:172843212-172843234 CTGGATATTAGCCCCTTATCAGG + Intronic
1001675177 5:173506302-173506324 CTGGCCATGGGTCCCTTTTCAGG + Intergenic
1002885816 6:1292906-1292928 CTGGACACGAGCTCCTCTTCAGG + Intergenic
1004110133 6:12709580-12709602 CTGGAAAAGAGCCTTTTTCCAGG + Intergenic
1004221274 6:13748532-13748554 CTGTGCAAGAGCCCCAATTCTGG + Intergenic
1004957640 6:20747721-20747743 TTGGACATGAACCCCTTATCAGG + Intronic
1005456214 6:26022020-26022042 CTGAACCAAAGGCCCTTTTCAGG + Intergenic
1008623981 6:53300046-53300068 CTGGACAACAGGCCCTAATCAGG + Intronic
1010065369 6:71676358-71676380 TTTGATAAGAGCACCTTTTCAGG + Intergenic
1010639681 6:78309086-78309108 CTAGACAAGAGCAATTTTTCTGG + Intergenic
1012043739 6:94242576-94242598 CTGGACATTAGCCCTTTGTCAGG - Intergenic
1012831024 6:104203585-104203607 CTGGATATTAGACCCTTTTCAGG - Intergenic
1014146930 6:118008642-118008664 CAGGATAAGAGAACCTTTTCTGG + Intronic
1015418745 6:132981976-132981998 CTGGATATTAGCCCCTTGTCAGG + Intergenic
1020193763 7:6020978-6021000 CTGGACAAGAACGCTTTTTCTGG + Intronic
1024082238 7:45865105-45865127 CCGGAAAAGTGCCCCTTCTCAGG + Intergenic
1028861955 7:95662456-95662478 CTGGACAATAACAACTTTTCAGG + Intergenic
1030002808 7:105083492-105083514 CTGGAGGAGAACCCTTTTTCTGG - Intronic
1030131388 7:106204660-106204682 CTGGACAAGAACCCTTTTTCTGG - Intergenic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1031380030 7:121074292-121074314 CTGGACAAGAGCCCCTTTTCTGG - Intronic
1032458166 7:132088868-132088890 CTCCACAGCAGCCCCTTTTCTGG - Intergenic
1032541321 7:132705480-132705502 GAGGACATAAGCCCCTTTTCAGG - Intronic
1036734060 8:11292790-11292812 CTGGGCAAGAGAAACTTTTCAGG - Intronic
1037616985 8:20528120-20528142 TTGGACAAGAGCCCCAAATCGGG - Intergenic
1039886389 8:41656464-41656486 CTGGAAAAGAGCAGCTTTGCTGG + Intronic
1039990718 8:42485296-42485318 CTTGACAAGCTCCCCTTTTTTGG - Intronic
1041841668 8:62279262-62279284 CTGGATATTAGCCCTTTTTCAGG + Intronic
1046960538 8:120108340-120108362 CATCACAACAGCCCCTTTTCTGG + Intronic
1050870302 9:10559659-10559681 CTGGATATTAGCCCTTTTTCAGG - Intronic
1051703968 9:19856861-19856883 CTGGACAAATCCCCCTTATCTGG + Intergenic
1052211625 9:25910899-25910921 CTGGACATTAGCCCTTTGTCAGG + Intergenic
1056529988 9:87478646-87478668 CAGGGCAAGACCCCCATTTCAGG + Intergenic
1057240643 9:93405509-93405531 CTGGATAGGATCCCTTTTTCTGG - Intergenic
1057448851 9:95138403-95138425 CTGGACAGGAACCCCTCTCCAGG - Intronic
1058156671 9:101524109-101524131 ATGGACACTAGCGCCTTTTCTGG + Intronic
1058582450 9:106473203-106473225 CTGGACATTAGCCCTTTGTCAGG + Intergenic
1203636351 Un_KI270750v1:116670-116692 CTGGATAACAGCCCCTGCTCTGG + Intergenic
1187731876 X:22263880-22263902 TTGGCCAAGAGCCCTTGTTCTGG + Intergenic
1189827660 X:44936260-44936282 CAGGACAAGCGCCTCCTTTCAGG + Intronic
1190503353 X:51100845-51100867 CTGGACGAGAGCCATTTGTCTGG + Intergenic
1192005950 X:67212579-67212601 CTGGACAAGAACACCATTACAGG - Intergenic
1192858778 X:75042990-75043012 CTGGATAATAGACCTTTTTCAGG - Intergenic
1193808471 X:86022559-86022581 CTGGGCAAGAGCAACTTTTAAGG - Intronic
1193930029 X:87542240-87542262 ATAGAAAAGAACCCCTTTTCTGG + Intronic
1196870399 X:120108181-120108203 ATGGAGAAGAGCCTCTTTTTGGG + Intergenic
1200100104 X:153685970-153685992 CTGGAGAAGAGCCCAGTTCCAGG + Intronic