ID: 1031381164

View in Genome Browser
Species Human (GRCh38)
Location 7:121087590-121087612
Sequence GGCTGTGCAGACCCAGATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031381164_1031381166 6 Left 1031381164 7:121087590-121087612 CCACTATCTGGGTCTGCACAGCC 0: 1
1: 0
2: 5
3: 22
4: 199
Right 1031381166 7:121087619-121087641 TGACAAAGAGTTCAAGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031381164 Original CRISPR GGCTGTGCAGACCCAGATAG TGG (reversed) Intronic