ID: 1031388356

View in Genome Browser
Species Human (GRCh38)
Location 7:121181136-121181158
Sequence GTGAGAGATGATCATACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031388356 Original CRISPR GTGAGAGATGATCATACTGC AGG Intronic
903087627 1:20876922-20876944 GTGAGCTATGATCATGCTACTGG + Intronic
903104697 1:21066102-21066124 GTGAGCCATGATCATACCACTGG + Intronic
905776575 1:40671457-40671479 GTGGGAGATGATTATACTAGGGG + Intergenic
906277271 1:44525820-44525842 GTGGGAGATGGTCAGACTGAGGG - Intronic
907212333 1:52834401-52834423 TTGAGAGCTGATGAGACTGCTGG - Intergenic
908973603 1:69868591-69868613 GGGAGAGATGGTCACACTGTGGG + Intronic
911417348 1:97591230-97591252 GTGAGAGATGAGGATAATGGTGG - Intronic
914460928 1:147884312-147884334 ATGAAAGAAAATCATACTGCAGG - Intergenic
916990662 1:170240732-170240754 GTGGGAGTTGATAATAGTGCTGG - Intergenic
917972147 1:180215458-180215480 GTGAGCCATGATTATACTACTGG + Intergenic
918464989 1:184811999-184812021 CTGAGAGCTGATGAGACTGCTGG + Intronic
919616914 1:199819395-199819417 GTGACAGATGATAAGACTACAGG + Intergenic
921326990 1:213996213-213996235 GTGAGAGAGAATCATATTACTGG + Intronic
1064310484 10:14208138-14208160 GTGAGCTATGATCACACTACTGG + Intronic
1064351739 10:14583345-14583367 GTCGGAGATGAAGATACTGCAGG + Intronic
1067420540 10:46141727-46141749 GTGACAGATGCACACACTGCAGG - Intergenic
1067425481 10:46207806-46207828 GTGACAGATGCACACACTGCAGG + Intergenic
1067505883 10:46848193-46848215 GTGACAGATGCACACACTGCAGG - Intergenic
1070063591 10:73010800-73010822 GTGAGCCATGTTTATACTGCTGG + Intronic
1072444081 10:95482881-95482903 GTGAGAGTTCATCAGACTGTTGG - Intronic
1073421634 10:103428543-103428565 GTCAGAGTTGAAGATACTGCAGG - Intronic
1080504492 11:32898999-32899021 GTGAGGGTTGAAAATACTGCAGG - Intronic
1086763879 11:90669861-90669883 GTCAGAGAAGATCCTACTGGTGG + Intergenic
1087227175 11:95614334-95614356 TTGAGAGATGATGGGACTGCTGG - Intergenic
1087524913 11:99297325-99297347 TTGAGAGATGATGGGACTGCTGG - Intronic
1092940941 12:13406299-13406321 ATGAGAGAAGAACAGACTGCAGG + Intergenic
1093050747 12:14501972-14501994 GTGAGAGATGAGGATACCACAGG - Intronic
1093460880 12:19405738-19405760 GTGAGGGATGTTCATAATGGGGG - Intronic
1094788387 12:33879173-33879195 CTGAGAGATGATCCAACTGCTGG + Intergenic
1096061451 12:48703868-48703890 GTGAGCCATGATCACACTACTGG + Intronic
1096611830 12:52807093-52807115 GGTAGAGATGATCTTGCTGCTGG + Exonic
1097249069 12:57622466-57622488 ATGAGAGAGGACCATAATGCAGG - Intronic
1098080760 12:66782924-66782946 GTGAGAAATGATCAGAATCCTGG - Intronic
1102948043 12:117007066-117007088 GTGAGAGATGAATATACAGAGGG + Intronic
1103850654 12:123930835-123930857 GTAAAAGATGAACATACGGCTGG + Intronic
1103889110 12:124225213-124225235 GTGTGCGATGAGCATGCTGCAGG + Intronic
1105293348 13:19068502-19068524 GGTAGAGATGATGATAATGCTGG - Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1106872625 13:34038117-34038139 GAGAAAAATGATCATTCTGCAGG + Intergenic
1109092204 13:58062256-58062278 GTGAAAGGTGACCACACTGCTGG + Intergenic
1112419598 13:99235910-99235932 GTGAGCTGTGATCATGCTGCTGG + Intronic
1113831818 13:113301565-113301587 GTGAGCGAAGATCATGCTACTGG + Intronic
1116329463 14:43577572-43577594 GTGAGAGTTGATGAGACTGCTGG + Intergenic
1117485491 14:56192691-56192713 GTGAGCGATGAGAAAACTGCGGG - Intronic
1118438364 14:65791356-65791378 GTGAGAGCTGCTCATAGTGAAGG + Intergenic
1121003724 14:90472698-90472720 TTGAGAGCTGATGAGACTGCTGG + Intergenic
1125952023 15:43760333-43760355 GTGAGCAATGATCATGCCGCTGG + Intronic
1127977929 15:64012214-64012236 GAAAGAGGTGACCATACTGCGGG + Intronic
1133847589 16:9469724-9469746 CTGACAGAAGATAATACTGCAGG + Intergenic
1134079984 16:11318455-11318477 GTGAGCTATGATCATGCCGCTGG - Intronic
1137322350 16:47397827-47397849 GGAAGAGAGGATCACACTGCAGG + Intronic
1137927816 16:52558014-52558036 GTGAGCCAAGATCACACTGCTGG - Intergenic
1139003900 16:62547865-62547887 TTGAGATATGACCAAACTGCAGG + Intergenic
1140605080 16:76526497-76526519 CTGAGAGATGATGGTGCTGCAGG + Intronic
1142019550 16:87772744-87772766 GTGAGCCAAGATCATGCTGCTGG - Intergenic
1146559682 17:33857370-33857392 GTGAGAGATGATGGGACTCCAGG + Intronic
1148704013 17:49611936-49611958 GTGAGCCATGATCATGCTACTGG - Intronic
1149624716 17:58072782-58072804 GTGAGCCATGATCACACTACTGG + Intergenic
1149796046 17:59521123-59521145 GTGAGCTATGATCATACCACGGG - Intergenic
1153938319 18:9952242-9952264 TTGAGAGATGATTCTGCTGCTGG + Intronic
1155850731 18:30770375-30770397 GTGAGAGCTGATGAGACTGCTGG + Intergenic
1163506471 19:17710110-17710132 GTGAGCCATGATCATGCTCCTGG + Intergenic
1165762722 19:38331272-38331294 GTGAGCCATGATCACACTACTGG + Intergenic
1166322970 19:42030512-42030534 GTGAGCTATGATCACGCTGCTGG - Intronic
1167407583 19:49323972-49323994 GTGAGAGGTGATCATGCCACTGG + Intronic
1168646908 19:58065247-58065269 GTGAGCCATGATCATACCACTGG - Intronic
925360077 2:3272536-3272558 GAGAGAGATGAGGAAACTGCCGG + Intronic
925786121 2:7432392-7432414 GACAGGGATGATCCTACTGCAGG - Intergenic
926575743 2:14578893-14578915 TTGAGAGATTATCATATTCCAGG - Intergenic
926586019 2:14686527-14686549 GTGAGAGGTGATCAGACCTCTGG + Intergenic
927298642 2:21484600-21484622 GTGAGCCATGATCATACCACTGG + Intergenic
928611015 2:32992819-32992841 GTGAGAGATGCTCCTCCAGCGGG + Intronic
929458237 2:42081673-42081695 GTGAGATATGATCATACCACAGG + Intergenic
934629184 2:95897107-95897129 GTGGGTGATGATGATGCTGCTGG - Intronic
938590373 2:132730130-132730152 GTGTGAGGTGAACACACTGCAGG - Intronic
939658038 2:144852115-144852137 GTGACAGAAGATGAAACTGCAGG - Intergenic
942337108 2:174900446-174900468 GTGAGCTATGATCATACTCCAGG + Intronic
942547911 2:177083929-177083951 GTGAGTCATGATCATGCTACTGG - Intergenic
943573820 2:189607201-189607223 ATGAGAGATGTTCATACCCCAGG + Intergenic
944070633 2:195664690-195664712 GAGTGCTATGATCATACTGCTGG + Intronic
945223936 2:207512539-207512561 GTGAGAGATGATGATGCCTCAGG + Intergenic
945704625 2:213213790-213213812 CTGAGAGATGATGGGACTGCTGG - Intergenic
947194961 2:227553438-227553460 GTGAGCCATGATCATGCTACTGG + Intronic
947226584 2:227846332-227846354 GTGAGCTATGATCACACTGCTGG - Intergenic
947771938 2:232676942-232676964 GTGAGCTATGATCATACCACTGG + Intronic
1169917484 20:10698022-10698044 TTGATATATGATCACACTGCAGG - Intergenic
1169934770 20:10871552-10871574 CTGAGAGATGCTGATGCTGCTGG + Intergenic
1170516742 20:17137913-17137935 TTGAGAGATGATCAGGCTGGGGG + Intergenic
1172453326 20:35045360-35045382 GAGAGAGATGATTAAACTGTGGG - Intronic
1175526722 20:59639339-59639361 GTGGGAAATGCTCATCCTGCAGG - Intronic
1175877146 20:62235748-62235770 CTGAGAAATGCTCATCCTGCAGG - Intronic
1178032228 21:28541194-28541216 GTGGGAGATGTTGATAATGCAGG - Intergenic
1183019929 22:35018825-35018847 CTGCAAGATGATCATACTTCCGG - Intergenic
949451282 3:4188074-4188096 GTGAGGGATGTTGATAATGCGGG - Intronic
951745897 3:25977056-25977078 GTGAGAGCTGATCATGTAGCAGG - Intergenic
952023892 3:29055978-29056000 ATGAGAGCTGATGAGACTGCTGG - Intergenic
952172480 3:30823304-30823326 GTGAGAAGTGATAATACTCCAGG - Intronic
953882564 3:46698653-46698675 CTGGGACATGAGCATACTGCCGG - Intergenic
954462043 3:50632833-50632855 GTGAGAGATGGAGATACTGTGGG + Intronic
955454126 3:59101242-59101264 TTGAGAGGTGATGAGACTGCTGG + Intergenic
956092634 3:65684116-65684138 GTGAGCTATGATCATGCCGCTGG + Intronic
956611215 3:71125159-71125181 GGGGGAGATGATGATACTGGTGG + Intronic
956922396 3:73943845-73943867 GTGAGAGATGAATATACTCCAGG - Intergenic
957724463 3:84046420-84046442 TTGAGAGATGAGGAGACTGCTGG + Intergenic
958126969 3:89368848-89368870 CTAAGGGATGCTCATACTGCTGG - Intronic
958194367 3:90223907-90223929 GTGAGAAATGAACAAACTCCTGG + Intergenic
958417733 3:93894958-93894980 GTGAGAAATGAACAAACTCCTGG + Intronic
959142191 3:102499837-102499859 GTGAGACATGATCATGCCACTGG - Intergenic
961270454 3:125683822-125683844 GGGAGAGATGATCACAGTGGAGG + Intergenic
962724411 3:138208409-138208431 GTGAGCCAAGATCATGCTGCTGG + Intronic
966072604 3:175896776-175896798 GTGGCAGAGGCTCATACTGCTGG - Intergenic
972818868 4:42676154-42676176 TTGAGAGCTGATGAGACTGCTGG + Intergenic
976163814 4:82231898-82231920 ATGAGAGCTGCTCATACAGCTGG + Intergenic
976514594 4:85950442-85950464 ATGAGTTATGATCATACTGCTGG + Intronic
979563710 4:122130241-122130263 GTGAGCTATGATCATACCACTGG - Intergenic
981504486 4:145483719-145483741 GTGAGAGATGATTTTTCTGGAGG + Intronic
987469676 5:18311977-18311999 GAGAGAGATGATTGTAGTGCTGG + Intergenic
989143558 5:38226083-38226105 GTGAGCCATGATCAAACTTCTGG + Intergenic
989337143 5:40331132-40331154 ATGAGAGATGATGACACTGCTGG - Intergenic
990856667 5:60274893-60274915 GTCACAGATGCTAATACTGCTGG - Intronic
992386987 5:76294100-76294122 GTGGGGGATGATGATCCTGCTGG + Intronic
992877799 5:81075148-81075170 GTAAGAGATGATTATAATGGAGG + Intronic
992880500 5:81104876-81104898 GTGAGAGATGAGCCCACTCCAGG - Intronic
996722733 5:126646167-126646189 GTGAGCCATGATCACACTACTGG - Intergenic
996731744 5:126723736-126723758 GTGTTAGCTGCTCATACTGCTGG - Intergenic
997279596 5:132631488-132631510 CTGAGAGATGTGCATACTCCAGG + Intronic
997529223 5:134571880-134571902 GTGGGAGTTGATCACACGGCAGG - Intronic
997730421 5:136168523-136168545 GTGAGAGATGCTGATAATGGAGG - Intronic
1001433236 5:171680002-171680024 GTAAGAGATGAAAACACTGCAGG + Intergenic
1003689558 6:8339340-8339362 GTGAGAGATGATAATAATGATGG - Intergenic
1008559158 6:52706016-52706038 TTGAGAGCTGATGAAACTGCTGG + Intergenic
1012182613 6:96173523-96173545 GTGAGAAAAGAACATACTGAAGG - Intronic
1014446274 6:121531584-121531606 GTGGGGGATAATCATACTGGGGG + Intergenic
1015407549 6:132854849-132854871 GTGAAAGATGCTCATTCTGGAGG + Intergenic
1016481880 6:144490877-144490899 GAGAGAGATAATCATCCTGATGG + Intronic
1016888713 6:148984300-148984322 GGGAGAGATGATCAGGCTGTGGG + Intronic
1018357525 6:163034211-163034233 TTGAGAGCTGATGAGACTGCTGG - Intronic
1022488563 7:30799422-30799444 GTGACAGATGCTCATACTCAGGG - Intronic
1026072234 7:67132164-67132186 GTGAGCCATGATCATACTTGTGG - Intronic
1031388356 7:121181136-121181158 GTGAGAGATGATCATACTGCAGG + Intronic
1033067520 7:138170424-138170446 GTGAAAGATCACCATACTGTGGG + Intergenic
1033439075 7:141362390-141362412 ATGAGAGATGATCAGGCTGCAGG - Intronic
1033940833 7:146650962-146650984 GTGAGATATGATCACGCTGGTGG + Intronic
1034142179 7:148831058-148831080 GTGGGCCATGATCATAGTGCTGG - Intronic
1035238465 7:157515452-157515474 GTGACAGACGCTGATACTGCTGG + Intergenic
1035546569 8:486337-486359 GTAAGAGTTGATGATGCTGCTGG - Intergenic
1038317822 8:26502513-26502535 GTGAGCCATGATCACACCGCTGG - Intronic
1043654800 8:82649595-82649617 GTGAGATATGATCTTACCCCAGG + Intergenic
1045428198 8:102087765-102087787 TTGAGAGCTGATGAGACTGCTGG + Intronic
1045653585 8:104365425-104365447 GTGAGACACGACCATCCTGCGGG + Intronic
1046137461 8:110048028-110048050 GTGACAGATGACAATGCTGCAGG + Intergenic
1048618059 8:136100972-136100994 CAGAGAGATGATCATACAGGTGG - Intergenic
1048968801 8:139632601-139632623 GAGAGAGAAAATCATACGGCAGG - Intronic
1050105483 9:2161918-2161940 GTGAGAGATGATCAAGGTGAAGG - Intronic
1050128082 9:2380225-2380247 GTCAGAGATGATATTACTCCAGG - Intergenic
1050176886 9:2877559-2877581 GTGACAGATGATCACAGTGCTGG - Intergenic
1050657751 9:7847752-7847774 ATGAGAGCTGATGAGACTGCTGG + Intronic
1052663782 9:31469256-31469278 TTGAGAGCTGATCAGACTACTGG - Intergenic
1052842242 9:33302415-33302437 GTGAGACATGATCACACCACTGG - Intronic
1056489640 9:87092782-87092804 GTGAGAAATCAACATAGTGCTGG - Intergenic
1056673389 9:88651315-88651337 GTGAGAGATGAGCATAGTTGGGG + Intergenic
1056938263 9:90934445-90934467 GTCAGAGATGACCATATTGCTGG + Intergenic
1059414691 9:114155642-114155664 GAGAGAGATGATCAAACTTTTGG - Exonic
1187311101 X:18143710-18143732 GTGAGGGATGTTGATAGTGCGGG + Intergenic
1187577038 X:20568141-20568163 GCGAGAGAGGATAATGCTGCAGG + Intergenic
1190014738 X:46817257-46817279 AGGATAGATGATGATACTGCAGG - Intergenic
1193315332 X:80058301-80058323 TTGAGAGCTGATGAGACTGCTGG - Intergenic
1193652055 X:84148758-84148780 GTGAGATATAATCTTATTGCTGG + Intronic
1195004690 X:100674147-100674169 GAGAGAGATGTTCATACAGGAGG - Intergenic
1198465793 X:136903705-136903727 GTGAGCCAAGATCATGCTGCTGG - Intergenic
1198587640 X:138140363-138140385 GAGAGAGAAGATAATACAGCAGG + Intergenic
1199240998 X:145547348-145547370 TTGAGTGATGCTGATACTGCAGG + Intergenic
1199805384 X:151294739-151294761 GTGAGAAATGATCAGTCTGAGGG - Intergenic
1201451572 Y:14121375-14121397 GTGATAGAAGATGATACTGATGG - Intergenic