ID: 1031390968

View in Genome Browser
Species Human (GRCh38)
Location 7:121214333-121214355
Sequence GCACCACTACACTCTAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426840
Summary {0: 132, 1: 4907, 2: 59368, 3: 149412, 4: 213021}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031390968_1031390971 17 Left 1031390968 7:121214333-121214355 CCCAGGCTAGAGTGTAGTGGTGC 0: 132
1: 4907
2: 59368
3: 149412
4: 213021
Right 1031390971 7:121214373-121214395 ACCTCCGCCTCACAAGATCAAGG No data
1031390968_1031390973 18 Left 1031390968 7:121214333-121214355 CCCAGGCTAGAGTGTAGTGGTGC 0: 132
1: 4907
2: 59368
3: 149412
4: 213021
Right 1031390973 7:121214374-121214396 CCTCCGCCTCACAAGATCAAGGG 0: 1
1: 1
2: 31
3: 636
4: 2258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031390968 Original CRISPR GCACCACTACACTCTAGCCT GGG (reversed) Intronic
Too many off-targets to display for this crispr