ID: 1031390971

View in Genome Browser
Species Human (GRCh38)
Location 7:121214373-121214395
Sequence ACCTCCGCCTCACAAGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031390969_1031390971 16 Left 1031390969 7:121214334-121214356 CCAGGCTAGAGTGTAGTGGTGCA 0: 87
1: 2653
2: 32209
3: 92044
4: 177766
Right 1031390971 7:121214373-121214395 ACCTCCGCCTCACAAGATCAAGG No data
1031390968_1031390971 17 Left 1031390968 7:121214333-121214355 CCCAGGCTAGAGTGTAGTGGTGC 0: 132
1: 4907
2: 59368
3: 149412
4: 213021
Right 1031390971 7:121214373-121214395 ACCTCCGCCTCACAAGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031390971 Original CRISPR ACCTCCGCCTCACAAGATCA AGG Intronic