ID: 1031390973 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:121214374-121214396 |
| Sequence | CCTCCGCCTCACAAGATCAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2927 | |||
| Summary | {0: 1, 1: 1, 2: 31, 3: 636, 4: 2258} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1031390969_1031390973 | 17 | Left | 1031390969 | 7:121214334-121214356 | CCAGGCTAGAGTGTAGTGGTGCA | 0: 87 1: 2653 2: 32209 3: 92044 4: 177766 |
||
| Right | 1031390973 | 7:121214374-121214396 | CCTCCGCCTCACAAGATCAAGGG | 0: 1 1: 1 2: 31 3: 636 4: 2258 |
||||
| 1031390968_1031390973 | 18 | Left | 1031390968 | 7:121214333-121214355 | CCCAGGCTAGAGTGTAGTGGTGC | 0: 132 1: 4907 2: 59368 3: 149412 4: 213021 |
||
| Right | 1031390973 | 7:121214374-121214396 | CCTCCGCCTCACAAGATCAAGGG | 0: 1 1: 1 2: 31 3: 636 4: 2258 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1031390973 | Original CRISPR | CCTCCGCCTCACAAGATCAA GGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||