ID: 1031390973 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:121214374-121214396 |
Sequence | CCTCCGCCTCACAAGATCAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 2927 | |||
Summary | {0: 1, 1: 1, 2: 31, 3: 636, 4: 2258} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1031390968_1031390973 | 18 | Left | 1031390968 | 7:121214333-121214355 | CCCAGGCTAGAGTGTAGTGGTGC | 0: 132 1: 4907 2: 59368 3: 149412 4: 213021 |
||
Right | 1031390973 | 7:121214374-121214396 | CCTCCGCCTCACAAGATCAAGGG | 0: 1 1: 1 2: 31 3: 636 4: 2258 |
||||
1031390969_1031390973 | 17 | Left | 1031390969 | 7:121214334-121214356 | CCAGGCTAGAGTGTAGTGGTGCA | 0: 87 1: 2653 2: 32209 3: 92044 4: 177766 |
||
Right | 1031390973 | 7:121214374-121214396 | CCTCCGCCTCACAAGATCAAGGG | 0: 1 1: 1 2: 31 3: 636 4: 2258 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1031390973 | Original CRISPR | CCTCCGCCTCACAAGATCAA GGG | Intronic | ||