ID: 1031391114

View in Genome Browser
Species Human (GRCh38)
Location 7:121216343-121216365
Sequence GGTCACATCCTTCAAAATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031391114_1031391119 26 Left 1031391114 7:121216343-121216365 CCCTCATTTTGAAGGATGTGACC 0: 1
1: 0
2: 1
3: 16
4: 159
Right 1031391119 7:121216392-121216414 TTATTCAGTACTTGGTTGCAGGG No data
1031391114_1031391118 25 Left 1031391114 7:121216343-121216365 CCCTCATTTTGAAGGATGTGACC 0: 1
1: 0
2: 1
3: 16
4: 159
Right 1031391118 7:121216391-121216413 GTTATTCAGTACTTGGTTGCAGG No data
1031391114_1031391117 18 Left 1031391114 7:121216343-121216365 CCCTCATTTTGAAGGATGTGACC 0: 1
1: 0
2: 1
3: 16
4: 159
Right 1031391117 7:121216384-121216406 ACATTCTGTTATTCAGTACTTGG 0: 1
1: 0
2: 1
3: 22
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031391114 Original CRISPR GGTCACATCCTTCAAAATGA GGG (reversed) Intronic
901183298 1:7356449-7356471 GGACACATCTTTCAAAAAGCAGG - Intronic
902663344 1:17920673-17920695 GGCCATAGACTTCAAAATGATGG - Intergenic
906469285 1:46114232-46114254 AGCCACATCATTCCAAATGAAGG + Intronic
910771957 1:90839807-90839829 GTTCACATACTTTAAAATAAAGG - Intergenic
911140730 1:94499528-94499550 GGTCATATCCTTGAACGTGAAGG + Exonic
911564967 1:99453371-99453393 GGACATTTCCTTCAAAATAAAGG + Intergenic
912662410 1:111544048-111544070 GTTCAAATGCTTCAAACTGAAGG - Intronic
913006058 1:114632510-114632532 AGACACAATCTTCAAAATGAAGG + Intronic
913034623 1:114951678-114951700 GGTCACATCTTACAAATTGTAGG + Intronic
917508894 1:175653604-175653626 AATCACATCCTTTAAAATCATGG - Intronic
918042110 1:180919714-180919736 GGTCTCCTCCTTGAAAATGAGGG - Intronic
918847032 1:189629111-189629133 GGTCCCACCCTTGAAAGTGAGGG - Intergenic
919432700 1:197516631-197516653 GGTCACAATCTTAAAAATAAAGG + Intronic
922345923 1:224696274-224696296 GGTCACTTCCTTCAAAGAAATGG - Intronic
922757442 1:228104340-228104362 CGTCACAACCTCCAAAATCAGGG - Intronic
922853614 1:228755467-228755489 GGTCACCTCCTTCAGCACGAGGG - Intergenic
923223185 1:231914792-231914814 GATCACATCTTGCAAAATGTAGG - Intronic
923742394 1:236667684-236667706 GTTAACATCCTTCAAGTTGAAGG - Intergenic
924596818 1:245453449-245453471 GGTCACATAATTCAAGGTGATGG - Intronic
1065255382 10:23861485-23861507 GGTCACATGCTTTAAAATGGAGG + Intronic
1066821607 10:39499369-39499391 TTGCAGATCCTTCAAAATGAGGG - Intergenic
1068881316 10:62052316-62052338 GCTGACATCCTTCAAGACGATGG - Intronic
1070013596 10:72502081-72502103 GTTCATATTCTTCAAAATGATGG + Intronic
1071711342 10:88052866-88052888 GCTCCAATCCTCCAAAATGAGGG - Intergenic
1071735912 10:88300506-88300528 AGCTAAATCCTTCAAAATGAGGG - Intronic
1072043174 10:91628910-91628932 ACTCACATCCTTCATATTGAAGG - Exonic
1074552639 10:114459097-114459119 GGTCACATGCTGCAAAAACAAGG + Intronic
1075934810 10:126331299-126331321 GGTCCCATCCTTCACCTTGAGGG - Intronic
1076517799 10:131058700-131058722 GGTTAAAACCTTCAAAATAATGG + Intergenic
1077429060 11:2506651-2506673 GGTCACATCCAACAAAACTACGG - Intronic
1078879878 11:15437624-15437646 GGTCAGATCCTTCATCATAAGGG - Intergenic
1079354665 11:19720197-19720219 GGTCACATTTTTCAAAGAGATGG + Intronic
1079399677 11:20096149-20096171 GATCAAATCCCCCAAAATGAAGG - Intronic
1080978590 11:37373597-37373619 GGACACCTCCTCCAAAGTGAAGG + Intergenic
1087075441 11:94123685-94123707 GGTCTTTTCCTTCAAAACGAGGG - Intergenic
1092868540 12:12785526-12785548 TGTCACGTCCTTCTAGATGAAGG + Intronic
1099613131 12:84901336-84901358 GGACAAATCCTTCAAAAAGATGG - Intronic
1100229900 12:92596345-92596367 GATTACATCCTCCACAATGAGGG - Intergenic
1101705306 12:107215683-107215705 GGTCTCTTCCTTCATAACGAGGG - Intergenic
1102058775 12:109916183-109916205 GGACACATGCTGCAGAATGAGGG + Intronic
1103063601 12:117878422-117878444 GGTCCCATTGTTCAAAATGTGGG - Intronic
1103287672 12:119816292-119816314 GTTCATATACTTCAAAATGGTGG - Intronic
1104345867 12:127997824-127997846 GGTCACATCCAGCCACATGAAGG + Intergenic
1104768177 12:131344094-131344116 GGTCTTTTCCTTCATAATGAGGG + Intergenic
1107431117 13:40341417-40341439 ATTCACATCCTTCAAAATTTAGG - Intergenic
1107518285 13:41153426-41153448 GGTTAAATGTTTCAAAATGAAGG + Intergenic
1112520469 13:100090028-100090050 GAACACATTCTTTAAAATGAAGG + Intronic
1113550774 13:111191511-111191533 GGTCTTTTCCTTCATAATGAGGG + Intronic
1116951842 14:50885717-50885739 TATCACTGCCTTCAAAATGAGGG - Intronic
1117464786 14:55982370-55982392 TCTCAAATCCTTCAAGATGAAGG - Intergenic
1121269841 14:92630840-92630862 GGTCACAAGCTTCTAAGTGATGG - Intronic
1202894479 14_KI270722v1_random:191130-191152 TGTAACATTCTGCAAAATGATGG - Intergenic
1129144110 15:73632640-73632662 GGTGACATCCTTAAAAATAAGGG - Intronic
1130642533 15:85691999-85692021 GGTCACTTCCTTTAAAAAAATGG - Intronic
1131524719 15:93143665-93143687 TGTCACATCATTCATAATCATGG - Intergenic
1132374516 15:101320027-101320049 TGTCAGATCCTACAAATTGAGGG - Intronic
1137835625 16:51589718-51589740 GGACCCATACTTTAAAATGAGGG + Intergenic
1140332037 16:74067803-74067825 GGTGACAACTTTCAATATGAGGG - Intergenic
1140591012 16:76352720-76352742 CATCACATCCTGAAAAATGAAGG + Intronic
1146154912 17:30515107-30515129 AGTCACACCCTTAAATATGAAGG - Intronic
1150853011 17:68723219-68723241 GGTCTTATCCTTCCATATGATGG - Intergenic
1152065125 17:78108204-78108226 GGTCAATTCCTTCGAAAAGATGG + Exonic
1156001549 18:32390511-32390533 GATCACATCATTCAACATAAAGG - Intronic
1156345684 18:36255285-36255307 GGTCACATACTTCAGAAGCAAGG - Intronic
1157838034 18:50926318-50926340 GAAAATATCCTTCAAAATGAAGG - Intronic
1157886123 18:51368602-51368624 GGGAACATGCTTCAAAATGGTGG + Intergenic
1158270757 18:55713171-55713193 GGTAACATCTTGCAAAATGATGG + Intergenic
1159495953 18:69204954-69204976 GGCCACATCTTTCTCAATGAAGG - Intergenic
1161612738 19:5252003-5252025 GGTCACATCCATCAATTTTAGGG + Intronic
1163298810 19:16430140-16430162 GGTCACATCCTCCAGGGTGAGGG - Intronic
1163826570 19:19527739-19527761 GGGCACGTCCTTCATGATGATGG - Exonic
1165220530 19:34312626-34312648 GGCCACAGCCTTTAAAAAGAAGG - Intronic
1165558837 19:36660660-36660682 GCTAAAATCCTTTAAAATGAAGG + Intronic
925995055 2:9285454-9285476 GCTCCCAGTCTTCAAAATGATGG + Intronic
926078560 2:9963981-9964003 GCTCACCTCCTTCAAGGTGATGG - Exonic
926497973 2:13616036-13616058 GGTCACATCCTTGAATCTGAGGG - Intergenic
927346185 2:22044311-22044333 TGACACATACTTCAAAATGGAGG + Intergenic
933630738 2:84654277-84654299 GGTGGCATCCTTCATAATGTTGG - Intronic
936653926 2:114462480-114462502 AGTCACATCCTACAAAATCAGGG - Intronic
936968729 2:118153289-118153311 GGACACTCACTTCAAAATGAAGG - Intergenic
937382760 2:121395732-121395754 GGCAACTTCCTTCAAACTGATGG - Intronic
939852339 2:147317123-147317145 GGTCTTTTCCTTCATAATGAGGG - Intergenic
944663827 2:201942630-201942652 GGACTCATCCTTCTAAATGGAGG - Intergenic
945142704 2:206703846-206703868 GGAGACATCCTTCAAAACAAGGG + Intronic
945421314 2:209640251-209640273 TGTCACCTCCTTCAACATGAGGG + Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
1169410462 20:5365046-5365068 GGTCACAAGATTCAAAATTAAGG + Intergenic
1169582721 20:7042705-7042727 GGTCACATTCTTCTAAATTATGG - Intergenic
1170361838 20:15554820-15554842 AGTCATTTCCTTCCAAATGAAGG - Intronic
1176169052 20:63688960-63688982 GGTCTCATGCTCCAAGATGAAGG - Intronic
1182018545 22:27061483-27061505 GTTCTCATCCTTCAGAATGTTGG + Intergenic
949739672 3:7216592-7216614 GGTCACATCTTTCAATATGTAGG + Intronic
949801647 3:7910980-7911002 GGTCACATCCACCATAAGGATGG + Intergenic
950247585 3:11435728-11435750 AATCACATCCTACAAAATGATGG - Intronic
952870296 3:37893597-37893619 GCTAACCACCTTCAAAATGAAGG - Intronic
954104517 3:48402767-48402789 GCTCACATGCTCCCAAATGATGG + Intergenic
954472427 3:50708913-50708935 GCTCACTTCCTTCACAAAGAAGG - Intronic
957632823 3:82740030-82740052 GTTCACATCCTGCAAAACTATGG - Intergenic
959349577 3:105244638-105244660 GGTAACATACTTAAAAATAATGG - Intergenic
960454137 3:117849534-117849556 AGACACATCCTTAGAAATGAAGG - Intergenic
960536195 3:118816911-118816933 ATTCACATCCTTAAAAAGGAGGG + Intergenic
963922566 3:150919828-150919850 AGTCACCTCCTTCAAAATGAAGG + Intronic
967156748 3:186699867-186699889 TATCATTTCCTTCAAAATGAAGG + Intergenic
969916906 4:10500171-10500193 GCTCACATCCTTAGAAATGGTGG + Intronic
971660760 4:29411822-29411844 GGTAACATTTTTCCAAATGAAGG + Intergenic
971898013 4:32621857-32621879 GGTGACATCCTTCAGTATTATGG + Intergenic
972871205 4:43300916-43300938 AGTCACATCCTTCATGATGGTGG + Intergenic
974527227 4:63060111-63060133 GGTCTTTTCCTTCATAATGAGGG - Intergenic
975052323 4:69881688-69881710 TGTGACCTCCTTCAAAATAAAGG - Intergenic
977884856 4:102243277-102243299 GGTCTTTTCCTTCATAATGAGGG - Intergenic
980807531 4:137833058-137833080 CTTCTCAGCCTTCAAAATGATGG - Intergenic
981123974 4:141084806-141084828 TGTCACATCCTTATACATGAAGG - Intronic
983897591 4:173098682-173098704 GGTCTCCTCCCTTAAAATGAAGG - Intergenic
984771125 4:183436872-183436894 GGTCCCATCCTACCAAATGGTGG - Intergenic
984939240 4:184917064-184917086 GGTCTTTTCCTTCATAATGAGGG + Intergenic
987162909 5:15163320-15163342 GGTTCCCTCCTTCAACATGAAGG + Intergenic
987447328 5:18036081-18036103 TGCCACATCCTTTAAAATGTTGG + Intergenic
989098468 5:37802862-37802884 GTTAACATCTTTCATAATGATGG + Intergenic
994200491 5:96969096-96969118 AATCAGATACTTCAAAATGAGGG + Intronic
994231060 5:97311013-97311035 GGTCTTTTCCTTCATAATGAGGG + Intergenic
994727597 5:103454586-103454608 GGTCACTCCTTTCAAAATGAGGG - Intergenic
996680891 5:126227353-126227375 GGTCTTTTCCTTCATAATGAGGG - Intergenic
997072980 5:130640222-130640244 GGTCTTTTCCTTCATAATGAGGG - Intergenic
999804167 5:155066583-155066605 TGTCAGAGCCTTCAAACTGATGG - Intergenic
1000278028 5:159756591-159756613 GGTCACATCCATCCAAGTAAAGG + Intergenic
1000855367 5:166391412-166391434 GGACATATCCTTCAAAATTGAGG + Intergenic
1003564661 6:7213089-7213111 TTTCTCATCCTTCAAATTGAAGG + Intronic
1008395836 6:51005338-51005360 TGTCACAGCCTTTAAAATGTAGG - Intergenic
1010016573 6:71111068-71111090 GGTGACATCCTTAGAAATGAAGG - Intergenic
1011113888 6:83868405-83868427 AGTCACATACCTTAAAATGATGG + Intronic
1011374382 6:86674106-86674128 GGTCTTTTCCTTCATAATGAGGG + Intergenic
1012013210 6:93819404-93819426 AGCCACATACTTCAAAAAGAAGG + Intergenic
1012866090 6:104619697-104619719 GGTAACATCTTACATAATGATGG - Intergenic
1013907168 6:115233886-115233908 GGTCTTTTCCTTCATAATGAGGG + Intergenic
1017391454 6:153944213-153944235 GTTCACATCCCTCAGTATGATGG + Intergenic
1019007864 6:168817439-168817461 GGTCTCAGCCTTCATAATCAAGG + Intergenic
1021341340 7:19466243-19466265 GATCAAAACCTTGAAAATGAAGG - Intergenic
1025493328 7:61162433-61162455 TTTCATATCCTTCAAAAAGAGGG - Intergenic
1025497550 7:61234541-61234563 TTTCAGATCCTTCAAAAAGAGGG - Intergenic
1025497871 7:61240009-61240031 TTTCAGATCCTTCAAAAAGAGGG - Intergenic
1027403347 7:77831845-77831867 AATCACATCCTGCAAAATGTTGG - Intronic
1027406464 7:77866950-77866972 TGTCACATGCTGCAATATGAAGG + Intronic
1028309023 7:89306293-89306315 GGTCAAATACTTCATAAGGAAGG + Intronic
1031306476 7:120132920-120132942 GAAAATATCCTTCAAAATGAAGG + Intergenic
1031391114 7:121216343-121216365 GGTCACATCCTTCAAAATGAGGG - Intronic
1033255596 7:139798851-139798873 GGCCACATCCTAGAAAATGGAGG - Intronic
1041128250 8:54667175-54667197 GTTCCTCTCCTTCAAAATGATGG - Intergenic
1042059613 8:64802524-64802546 TGTCACTTCCTTCAAAAAGCTGG + Intergenic
1043164007 8:76880501-76880523 AGTCAGTTGCTTCAAAATGATGG + Intergenic
1047614523 8:126552581-126552603 TATCATTTCCTTCAAAATGAAGG - Exonic
1055266905 9:74503713-74503735 GGAGACATCCTTCAAATTCATGG - Intronic
1055861477 9:80755056-80755078 GGTTACATCCTTGAAATTTAGGG + Intergenic
1056392111 9:86150024-86150046 GGTCTTTTCCTTCATAATGAGGG + Intergenic
1058960612 9:109989511-109989533 AGTCACATTCTTCAGAGTGATGG + Intronic
1059591340 9:115666084-115666106 GGTCCCTTCCTTCAACATGTAGG + Intergenic
1059851020 9:118339700-118339722 GGTCACCTCCTAAAAAATGAAGG - Intergenic
1060705835 9:125799829-125799851 TTTCACATCCTTCTAAATCAGGG + Intronic
1062145186 9:134985152-134985174 TGGCACATCCTTCAAAACCAGGG - Intergenic
1185600102 X:1333194-1333216 GGTAACATCTTACAAAATGAGGG - Intergenic
1185767181 X:2735018-2735040 GGACACATCCTTCAAAGAGTTGG - Intronic
1186258940 X:7755304-7755326 GGTCATATCCTTCCAAATCTGGG - Intergenic
1186317461 X:8386286-8386308 TGACACATCCTTCAAGATGTTGG - Intergenic
1187366834 X:18672696-18672718 GGTCACCCCCTAAAAAATGATGG - Intergenic
1187402482 X:18974049-18974071 GAGCACATCCATCAAAACGAGGG - Intronic
1187521351 X:20017382-20017404 TGGCACATGCTTCCAAATGAAGG - Intronic
1189174918 X:38946691-38946713 GGCCACATACTACAGAATGAGGG + Intergenic
1192310710 X:70011778-70011800 GAAACCATCCTTCAAAATGAAGG - Intronic
1192909104 X:75584275-75584297 GGTAGAAGCCTTCAAAATGAAGG + Intergenic
1194709339 X:97216195-97216217 GGAAACATCTTTTAAAATGATGG + Intronic
1195132296 X:101865146-101865168 GAAAACATCCTTCAACATGAAGG + Intergenic
1195501121 X:105601315-105601337 GCTCACCTCCTTCACAAAGAAGG + Intronic
1196489397 X:116248957-116248979 GGTCTTTTCCTTCATAATGAGGG - Intergenic
1196935463 X:120726244-120726266 GGTGACATCTATGAAAATGATGG - Intergenic
1197514026 X:127402129-127402151 GGTCTTTTCCTTCATAATGAGGG - Intergenic
1197804073 X:130382787-130382809 GGTGACATCCTTTGAAAGGAGGG + Intergenic
1199650641 X:149944137-149944159 GGTCACAGCCTTCAGATGGAGGG - Intergenic
1201907690 Y:19102300-19102322 GATCTCTTCCTTCATAATGAGGG + Intergenic