ID: 1031392646

View in Genome Browser
Species Human (GRCh38)
Location 7:121234498-121234520
Sequence GGCTGTTCCTCCATTCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031392646_1031392648 -7 Left 1031392646 7:121234498-121234520 CCTCCTAGAATGGAGGAACAGCC 0: 1
1: 0
2: 1
3: 13
4: 94
Right 1031392648 7:121234514-121234536 AACAGCCAAGTCTCCAGCTGAGG 0: 1
1: 0
2: 2
3: 25
4: 205
1031392646_1031392649 -4 Left 1031392646 7:121234498-121234520 CCTCCTAGAATGGAGGAACAGCC 0: 1
1: 0
2: 1
3: 13
4: 94
Right 1031392649 7:121234517-121234539 AGCCAAGTCTCCAGCTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031392646 Original CRISPR GGCTGTTCCTCCATTCTAGG AGG (reversed) Intronic