ID: 1031392646

View in Genome Browser
Species Human (GRCh38)
Location 7:121234498-121234520
Sequence GGCTGTTCCTCCATTCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031392646_1031392649 -4 Left 1031392646 7:121234498-121234520 CCTCCTAGAATGGAGGAACAGCC 0: 1
1: 0
2: 1
3: 13
4: 94
Right 1031392649 7:121234517-121234539 AGCCAAGTCTCCAGCTGAGGTGG No data
1031392646_1031392648 -7 Left 1031392646 7:121234498-121234520 CCTCCTAGAATGGAGGAACAGCC 0: 1
1: 0
2: 1
3: 13
4: 94
Right 1031392648 7:121234514-121234536 AACAGCCAAGTCTCCAGCTGAGG 0: 1
1: 0
2: 2
3: 25
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031392646 Original CRISPR GGCTGTTCCTCCATTCTAGG AGG (reversed) Intronic
901794311 1:11671747-11671769 GGCTTTTCCTCCAGTGCAGGAGG - Intronic
902370823 1:16005900-16005922 GTCTTTTCCTCTCTTCTAGGTGG + Exonic
909643090 1:77888538-77888560 GCCTGTTCCCGCATTCCAGGCGG - Intronic
910425987 1:87120497-87120519 GGTTGTGTCTCCATTGTAGGTGG + Intronic
911160106 1:94675496-94675518 GGCTGTTCCTTGATTCTGGTGGG + Intergenic
916118212 1:161506130-161506152 GGCAGTTCCCCCATTTTAGTGGG + Intronic
919344982 1:196363572-196363594 GGATGTTAATCCATTCTATGAGG - Intronic
920701763 1:208223356-208223378 GGCGCTTCCTCCATTGTAGGTGG + Intronic
922764761 1:228151039-228151061 GGCTGTTCCTCCTCTGGAGGTGG - Intronic
924470692 1:244340255-244340277 GGCAGGGCCTCCAATCTAGGAGG - Intergenic
1063246981 10:4231568-4231590 GGGGGTTCCTCCACTCTATGGGG - Intergenic
1066489975 10:35884886-35884908 GGCTGCTCCTCCAGCCCAGGTGG + Intergenic
1068834456 10:61538457-61538479 TGCATTGCCTCCATTCTAGGTGG - Intergenic
1075153591 10:119956186-119956208 GGCTGTACCTCCATGGTAGAAGG + Intergenic
1077219757 11:1410732-1410754 GGCTGGTCCTCCATTCTCAGGGG + Intronic
1078939342 11:15984355-15984377 GGCTGTTCCGCCAGTCTGGAAGG - Intronic
1080676426 11:34432075-34432097 GGCTGTTCCTCAATCCCATGTGG + Intergenic
1084013224 11:66364136-66364158 GGCCGTCCCTCCATTGCAGGCGG + Intronic
1085058074 11:73419590-73419612 GACTGTTACTGCATTTTAGGGGG - Intronic
1085793850 11:79519212-79519234 GGTTGTTCCTCATTACTAGGAGG + Intergenic
1099867425 12:88300988-88301010 GGCTGCTCCTTCATTTTAGAGGG + Intergenic
1101635461 12:106536991-106537013 GGTTTTTCCTCCATCCCAGGTGG + Intronic
1107540363 13:41383930-41383952 GGATGTTCCTTCTTTTTAGGGGG + Intergenic
1118321243 14:64754595-64754617 GGCTGTGCCTCCTTACGAGGGGG - Intronic
1126161390 15:45616890-45616912 CCCTGTTCCTCCATTCTGAGAGG - Intronic
1127417602 15:58772034-58772056 GGCTGTTCCTCTGTGCAAGGAGG + Exonic
1131130264 15:89894463-89894485 GGCTGTTCCTCTATGGTAGACGG + Intronic
1142428601 16:90013831-90013853 GGCTGTGCTCCCATTTTAGGGGG + Intronic
1143419856 17:6780279-6780301 TGCTGTTCCTCCATACCAGGCGG - Exonic
1143760596 17:9100921-9100943 TGCTGTTCCTCCCTTCCTGGAGG + Intronic
1146735294 17:35233380-35233402 GGCTGTTCCAGGATTCTATGAGG + Intergenic
1147655628 17:42089010-42089032 GGCTGTTCTGCCAATCCAGGTGG - Intergenic
1150994515 17:70300680-70300702 GGCTTTTTCCCCATTGTAGGAGG + Intergenic
1152202867 17:78957253-78957275 CGCTGGTCCTCCATGCAAGGAGG + Intergenic
1153198977 18:2630293-2630315 GTCTGTTCCAACATTCTAGAAGG - Intergenic
1155525614 18:26713517-26713539 GGCTGCTCCTTCATTCTAGTAGG + Intergenic
1157740699 18:50090193-50090215 TGGTGTTCCTCCACTCCAGGAGG + Intronic
1160539423 18:79612361-79612383 GGCCGTTCCTCTATTCTAGGAGG - Intergenic
1160798048 19:954776-954798 GGCTGTTCCTCCCGTCTGCGAGG - Intronic
1161477803 19:4496080-4496102 GGCTGTTCCTCCACTGAATGGGG + Intronic
1163304267 19:16467936-16467958 GTAGGTGCCTCCATTCTAGGAGG - Intronic
1163849594 19:19655654-19655676 GGCTGTTCCTCCATTCCTCCAGG - Exonic
1164636097 19:29792496-29792518 GGGTGTGCCTCCATTCCAGGAGG + Intergenic
1166643520 19:44514032-44514054 GTCTGTGCCTCTATTCTGGGAGG - Intronic
927511439 2:23646602-23646624 GGCTTGTCCTCCCTTCTGGGAGG + Intronic
929103053 2:38335620-38335642 AGCATTTCCTGCATTCTAGGAGG - Intronic
929481459 2:42312361-42312383 GGCTTTTCCTGAATTCTAAGAGG - Intronic
929893169 2:45936090-45936112 GGCTGATCCTTCACCCTAGGAGG + Intronic
930211472 2:48643129-48643151 TGATGTTGCTCCATTCTAGAGGG - Intronic
943774237 2:191747881-191747903 GGCTGTTCCTCAATTAGAGAGGG - Intergenic
946635196 2:221717311-221717333 GACTGTTCCTACATGCTAAGTGG - Intergenic
947806775 2:232974321-232974343 CGCTGTACATGCATTCTAGGAGG - Intronic
948544108 2:238714207-238714229 CGCTGTTCCTCCACTCTCAGTGG - Intergenic
948608417 2:239151409-239151431 GGGTTTTCCTCCATTTTGGGGGG - Intronic
1168895437 20:1320480-1320502 GTCTGTGCCTCCTTTCAAGGGGG - Intronic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1175580593 20:60095802-60095824 GTCAGTTCCTCCTTCCTAGGTGG - Intergenic
1177949744 21:27519914-27519936 GTGTTTTCCTCCTTTCTAGGAGG + Intergenic
1178924946 21:36767064-36767086 TCCTCTTCCTCCATTCCAGGCGG + Intronic
1179564102 21:42235569-42235591 GGCTGTCCCACCTTTCTAGACGG - Intronic
1181164897 22:20977941-20977963 GGTTGTTCCTCCAGGCAAGGGGG - Exonic
1182162999 22:28142298-28142320 GGTTACTCCTCTATTCTAGGCGG - Intronic
956246574 3:67190368-67190390 GTCTGTTCCTCCTTTCTACTGGG + Intergenic
959564876 3:107824127-107824149 GGATGTTCCTCTCCTCTAGGAGG + Intergenic
964294398 3:155217377-155217399 GGCTGTTCCTAAATGCAAGGTGG - Intergenic
966518562 3:180847215-180847237 GGCTTTTCCTCCATTCAAGAGGG - Intronic
970551699 4:17188250-17188272 GGCTTTTCCTCTATCCTACGTGG + Intergenic
978676522 4:111325607-111325629 TGCTGTCCCTCCATTCTTGCTGG - Intergenic
984164305 4:176288926-176288948 GGATGTTCCTTCAATCTGGGTGG + Intergenic
986306210 5:6518972-6518994 GGAGGTTCCTCCATGCCAGGTGG - Intergenic
992283030 5:75201753-75201775 GGCTTTTCCTCAATTCCAGAAGG - Intronic
992381854 5:76245313-76245335 GCCTGTTTCTCCATTCTAGCAGG - Intronic
995538467 5:113160838-113160860 AGCTATTCCTACATTCTATGTGG + Intronic
999941959 5:156552594-156552616 GGATGTTCCTCCATTCACAGGGG - Intronic
1005600326 6:27420331-27420353 GTCTATTCCTCTATGCTAGGTGG + Intergenic
1007605431 6:43114507-43114529 GGCTGTGCCCCCATTCCAGGGGG - Intronic
1008249634 6:49224129-49224151 GGTTGTTCCTCCTTGCTGGGTGG + Intergenic
1016372589 6:143390652-143390674 GGCTTTCCCTCCACTCTGGGTGG - Intergenic
1017348297 6:153409823-153409845 AGCTGTTTCTCCAATTTAGGTGG + Intergenic
1019729479 7:2622433-2622455 GGATGTGGCTCCATTCCAGGGGG - Intergenic
1025051343 7:55737129-55737151 GGCTCCTCCTCCATGGTAGGAGG - Intergenic
1030533028 7:110733797-110733819 GGCCCTTCCTCCATTATATGAGG + Intronic
1031392646 7:121234498-121234520 GGCTGTTCCTCCATTCTAGGAGG - Intronic
1035022771 7:155808953-155808975 GGCTGTTCCACCAAGCTTGGGGG - Intronic
1036086445 8:5617801-5617823 GGTTGTTCCTCCAAGCTATGTGG - Intergenic
1037227814 8:16615571-16615593 GGCTGTTCCATCATTATAGAAGG - Intergenic
1037466605 8:19167313-19167335 GGATGTTCCTGCATTCTACTGGG - Intergenic
1038192706 8:25338550-25338572 GACTGTCCCTCCTTTCCAGGTGG + Intronic
1038457527 8:27687102-27687124 GCCTGTTCCTGCAATCAAGGTGG - Intergenic
1042762962 8:72290834-72290856 AGCTGTTTCTCCATTGTAGTAGG + Intergenic
1047525222 8:125627293-125627315 GGCTGTTCCTCCCCTCTATCTGG - Intergenic
1048608623 8:135997341-135997363 GTCTGTTCCTCCAATCTTGGGGG - Intergenic
1049252839 8:141598352-141598374 GGCTGTTCCTTCAGCCTGGGAGG + Intergenic
1049867362 8:144947473-144947495 TGCTGTTCTCCCACTCTAGGTGG - Intronic
1050019231 9:1266727-1266749 GCCTGTTCCTCCATTCCAGCTGG + Intergenic
1050625762 9:7502329-7502351 GGCTGTTCCTCCATTGAATGTGG + Intergenic
1052004637 9:23330915-23330937 GCCTGTACCTCCATTGTATGTGG + Intergenic
1057554660 9:96078076-96078098 GGCAGTTTCTCCACTCTAGAAGG + Intergenic
1060269863 9:122132659-122132681 GGCTTATCCTCTAATCTAGGGGG - Intergenic
1060406312 9:123374744-123374766 GGCTGTTCCTCCAGCCAGGGTGG + Intronic
1061722584 9:132561928-132561950 GGCCGTTCCTCCTTGCGAGGCGG - Intronic
1186368798 X:8925639-8925661 TGCTGTTCCTTCATTCTGGGGGG - Intergenic
1188399305 X:29725328-29725350 TGATGTTCCTCCATTATATGAGG + Intronic
1189271945 X:39758120-39758142 GGCTGTTCCTCCGGTCTGGGAGG - Intergenic
1190640021 X:52475281-52475303 GGCTGTTGCTTCATACTATGGGG - Intergenic
1190647651 X:52537584-52537606 GGCTGTTGCTTCATACTATGGGG + Intergenic
1195560801 X:106281167-106281189 GATTGTTTCTCCATTCCAGGAGG + Intergenic
1197433282 X:126393313-126393335 GCCTGTTCCTCAATTTTAGCAGG + Intergenic
1200179857 X:154143712-154143734 GGCTCCTCCTCCAGTGTAGGGGG - Intergenic