ID: 1031392647

View in Genome Browser
Species Human (GRCh38)
Location 7:121234501-121234523
Sequence CTTGGCTGTTCCTCCATTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031392647_1031392648 -10 Left 1031392647 7:121234501-121234523 CCTAGAATGGAGGAACAGCCAAG No data
Right 1031392648 7:121234514-121234536 AACAGCCAAGTCTCCAGCTGAGG 0: 1
1: 0
2: 2
3: 25
4: 205
1031392647_1031392649 -7 Left 1031392647 7:121234501-121234523 CCTAGAATGGAGGAACAGCCAAG No data
Right 1031392649 7:121234517-121234539 AGCCAAGTCTCCAGCTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031392647 Original CRISPR CTTGGCTGTTCCTCCATTCT AGG (reversed) Intronic