ID: 1031392647 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:121234501-121234523 |
Sequence | CTTGGCTGTTCCTCCATTCT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1031392647_1031392648 | -10 | Left | 1031392647 | 7:121234501-121234523 | CCTAGAATGGAGGAACAGCCAAG | No data | ||
Right | 1031392648 | 7:121234514-121234536 | AACAGCCAAGTCTCCAGCTGAGG | 0: 1 1: 0 2: 2 3: 25 4: 205 |
||||
1031392647_1031392649 | -7 | Left | 1031392647 | 7:121234501-121234523 | CCTAGAATGGAGGAACAGCCAAG | No data | ||
Right | 1031392649 | 7:121234517-121234539 | AGCCAAGTCTCCAGCTGAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1031392647 | Original CRISPR | CTTGGCTGTTCCTCCATTCT AGG (reversed) | Intronic | ||