ID: 1031393792

View in Genome Browser
Species Human (GRCh38)
Location 7:121247866-121247888
Sequence CTGCTTAGCCAGAAGAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 194}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031393781_1031393792 22 Left 1031393781 7:121247821-121247843 CCCAAGTTTCCCTATCTCCCTCC 0: 1
1: 0
2: 0
3: 50
4: 477
Right 1031393792 7:121247866-121247888 CTGCTTAGCCAGAAGAAAATAGG 0: 1
1: 0
2: 1
3: 15
4: 194
1031393785_1031393792 5 Left 1031393785 7:121247838-121247860 CCCTCCAAGAAGTTTTATCCCCA 0: 1
1: 0
2: 3
3: 17
4: 177
Right 1031393792 7:121247866-121247888 CTGCTTAGCCAGAAGAAAATAGG 0: 1
1: 0
2: 1
3: 15
4: 194
1031393779_1031393792 24 Left 1031393779 7:121247819-121247841 CCCCCAAGTTTCCCTATCTCCCT 0: 1
1: 0
2: 3
3: 46
4: 436
Right 1031393792 7:121247866-121247888 CTGCTTAGCCAGAAGAAAATAGG 0: 1
1: 0
2: 1
3: 15
4: 194
1031393778_1031393792 28 Left 1031393778 7:121247815-121247837 CCATCCCCCAAGTTTCCCTATCT 0: 1
1: 0
2: 3
3: 42
4: 434
Right 1031393792 7:121247866-121247888 CTGCTTAGCCAGAAGAAAATAGG 0: 1
1: 0
2: 1
3: 15
4: 194
1031393780_1031393792 23 Left 1031393780 7:121247820-121247842 CCCCAAGTTTCCCTATCTCCCTC 0: 1
1: 0
2: 1
3: 40
4: 388
Right 1031393792 7:121247866-121247888 CTGCTTAGCCAGAAGAAAATAGG 0: 1
1: 0
2: 1
3: 15
4: 194
1031393786_1031393792 4 Left 1031393786 7:121247839-121247861 CCTCCAAGAAGTTTTATCCCCAG 0: 1
1: 0
2: 2
3: 17
4: 133
Right 1031393792 7:121247866-121247888 CTGCTTAGCCAGAAGAAAATAGG 0: 1
1: 0
2: 1
3: 15
4: 194
1031393784_1031393792 12 Left 1031393784 7:121247831-121247853 CCTATCTCCCTCCAAGAAGTTTT 0: 1
1: 0
2: 7
3: 21
4: 224
Right 1031393792 7:121247866-121247888 CTGCTTAGCCAGAAGAAAATAGG 0: 1
1: 0
2: 1
3: 15
4: 194
1031393787_1031393792 1 Left 1031393787 7:121247842-121247864 CCAAGAAGTTTTATCCCCAGCCT 0: 1
1: 0
2: 0
3: 15
4: 189
Right 1031393792 7:121247866-121247888 CTGCTTAGCCAGAAGAAAATAGG 0: 1
1: 0
2: 1
3: 15
4: 194
1031393777_1031393792 29 Left 1031393777 7:121247814-121247836 CCCATCCCCCAAGTTTCCCTATC 0: 1
1: 0
2: 3
3: 24
4: 273
Right 1031393792 7:121247866-121247888 CTGCTTAGCCAGAAGAAAATAGG 0: 1
1: 0
2: 1
3: 15
4: 194
1031393782_1031393792 21 Left 1031393782 7:121247822-121247844 CCAAGTTTCCCTATCTCCCTCCA 0: 1
1: 0
2: 6
3: 60
4: 503
Right 1031393792 7:121247866-121247888 CTGCTTAGCCAGAAGAAAATAGG 0: 1
1: 0
2: 1
3: 15
4: 194
1031393783_1031393792 13 Left 1031393783 7:121247830-121247852 CCCTATCTCCCTCCAAGAAGTTT 0: 1
1: 0
2: 1
3: 29
4: 259
Right 1031393792 7:121247866-121247888 CTGCTTAGCCAGAAGAAAATAGG 0: 1
1: 0
2: 1
3: 15
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031393792 Original CRISPR CTGCTTAGCCAGAAGAAAAT AGG Intronic
900814273 1:4831310-4831332 CTGCTTCCCCACCAGAAAATGGG - Intergenic
901567816 1:10133164-10133186 CTGCTTTGCCAGAGGAGAAAAGG + Intronic
903058869 1:20655605-20655627 CTGCTTAGCCAAAAGCCAAGAGG - Intronic
906302818 1:44696011-44696033 CAGCCTAGCCTGAAGAAAAAGGG + Intronic
906996091 1:50795872-50795894 CTGATTACCAAGAAAAAAATTGG + Intronic
907814144 1:57901603-57901625 CTCCCTAGCCAGCAGAAAAGGGG + Intronic
909020144 1:70422094-70422116 CTGCATAGCCAAAAGAGTATTGG + Intronic
913210156 1:116575684-116575706 ATGCTTGGCCAGAAAAATATGGG + Exonic
913389625 1:118295926-118295948 TTGAATAGCCAGAAGAAATTTGG - Intergenic
915701056 1:157797293-157797315 CTTAGTAGCCAGAGGAAAATTGG + Intronic
920891885 1:209994803-209994825 CTCACTAGCCAGAAGAAATTGGG + Intronic
923886503 1:238163927-238163949 GTGCTGAGCCAGCTGAAAATGGG + Intergenic
1068311979 10:55290626-55290648 CATCTTAGCAAGATGAAAATGGG + Intronic
1068441289 10:57057746-57057768 CTGCTGAGAAAGAAGAAACTTGG - Intergenic
1069809326 10:71146801-71146823 CTGTTTAGACAGCAGAAATTGGG - Intergenic
1070654610 10:78262736-78262758 CTGCAGAGCCAGCAGAAAATGGG - Intergenic
1073599913 10:104836489-104836511 CTGCTTGGGGACAAGAAAATTGG + Intronic
1074034994 10:109729528-109729550 CTACCTATCCAAAAGAAAATGGG - Intergenic
1074563901 10:114559206-114559228 TTGCATAGCAAGAGGAAAATGGG + Intronic
1075202324 10:120415252-120415274 TTGCTTAGCCAGAAGAGTCTAGG - Intergenic
1075954288 10:126508739-126508761 CTGCTAAGCAAGGAGAAAACAGG + Intronic
1076256446 10:129029710-129029732 CTGCTTTGCAAACAGAAAATTGG - Intergenic
1079224589 11:18594528-18594550 CTGGTTAACAAGAAAAAAATTGG + Intergenic
1081181845 11:39993336-39993358 CTGCTTAACCCCAAGAAATTTGG + Intergenic
1081581734 11:44356772-44356794 CTTCATAGCCAGAAAAAAAAAGG - Intergenic
1081730507 11:45368801-45368823 CTGTTAAGACAGATGAAAATGGG + Intergenic
1081903444 11:46649615-46649637 CTGCCTTGAAAGAAGAAAATGGG - Intronic
1082733315 11:56826537-56826559 CTTATAAGCCAGAAGAAATTGGG + Intergenic
1083075923 11:60037637-60037659 CTGGCTAACTAGAAGAAAATTGG + Intergenic
1085757073 11:79210660-79210682 CTGCTTATCCATCTGAAAATGGG + Intronic
1089813016 11:121147280-121147302 CTCCTTTTCCAGATGAAAATGGG - Intronic
1090245677 11:125214428-125214450 ACTCTTAGCCAGAAGAAAAGAGG - Intronic
1091112411 11:132982157-132982179 CAGCAAAGGCAGAAGAAAATGGG - Intronic
1094566911 12:31607126-31607148 CAGCAAAGGCAGAAGAAAATTGG - Intergenic
1095394775 12:41749443-41749465 CTATTTAGCCTCAAGAAAATAGG - Intergenic
1096113818 12:49043578-49043600 CTCCTAAGCCAGAAGAAAGTTGG + Intronic
1096214148 12:49790308-49790330 CTCCTTCCCCAGAAGGAAATAGG + Intergenic
1097379940 12:58882735-58882757 CTGCTGAGGTAGAGGAAAATGGG - Intronic
1097585183 12:61506791-61506813 CTGCTTTGAGAAAAGAAAATGGG - Intergenic
1100595346 12:96066817-96066839 CTACTTTGCCTGAAAAAAATGGG - Intergenic
1101201626 12:102442279-102442301 CTGCCTAGACAGAAGTGAATGGG + Intronic
1101334083 12:103781129-103781151 CTGTTTAGCCATAAGAACCTTGG - Intronic
1101391095 12:104301260-104301282 CCTCTGAGCCAGAAGAAAATAGG + Intronic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1108300823 13:49073957-49073979 CTGCCTTGACAGATGAAAATAGG - Intronic
1108486150 13:50927941-50927963 CTTTTTGGTCAGAAGAAAATAGG - Intronic
1110405146 13:75142822-75142844 CTCCTGAGGTAGAAGAAAATAGG - Intergenic
1110934575 13:81271322-81271344 CTGCTTAGACAAAGGAGAATAGG + Intergenic
1114511377 14:23264356-23264378 CTCCATTGCCAAAAGAAAATAGG - Intronic
1114755957 14:25260416-25260438 GTGTTTAGCCAGATGAAAACTGG - Intergenic
1118004877 14:61556511-61556533 CAGCTTGGCCATAAGGAAATGGG - Intronic
1118837410 14:69486588-69486610 CTGCTGAGGCAGAAGAAAGATGG - Intronic
1120339382 14:83199950-83199972 TTGCTTAGCCAGATGTTAATAGG - Intergenic
1121158354 14:91709298-91709320 CCACTTACCCAGCAGAAAATTGG - Intronic
1122384278 14:101333430-101333452 CTGGTGACCCAGAAGAAAAAGGG + Intergenic
1126229728 15:46310758-46310780 CTGCTTAGCTAGAAGATCACTGG - Intergenic
1126304978 15:47245659-47245681 ATGCTTAGCATGCAGAAAATTGG - Intronic
1126333013 15:47554328-47554350 CTGCTTAGCCTGGAGAAGACAGG + Intronic
1126968324 15:54082113-54082135 CTTCTAAACCAGAAGAAATTAGG - Intronic
1127284522 15:57520837-57520859 CAGCTTAACCAGAAGGAAGTTGG - Intronic
1128056269 15:64702474-64702496 CTGCTAGGCCTGAAGAGAATGGG + Intronic
1129865729 15:78907119-78907141 CTGATTACCAAGAAGAAATTTGG + Intergenic
1129937837 15:79465602-79465624 CGGCTCAGACAGAAGGAAATTGG - Intronic
1131712192 15:95068035-95068057 CTGCATGGGCAGAAGATAATTGG - Intergenic
1134233631 16:12448835-12448857 ATGCTTAGTTAGAAGAAAATGGG - Intronic
1135990359 16:27215162-27215184 CTGCTTAGCCAGCAGACATGAGG + Intronic
1138933211 16:61687244-61687266 CTTCTAAGCCAAAAAAAAATCGG + Intronic
1140648997 16:77066241-77066263 GTGGTTATCCAGAAGAAAATGGG - Intergenic
1143053864 17:4148166-4148188 CTGCTTAGGCAGAAAATAACAGG + Intronic
1144019783 17:11230039-11230061 GTGCTTAACAATAAGAAAATTGG + Intergenic
1150597631 17:66620372-66620394 CTGGGTAGGCAGAAGAAAAGGGG + Intronic
1153352582 18:4097327-4097349 CTGCTGAGACAGATGTAAATGGG - Intronic
1155876363 18:31094841-31094863 CTGCATAGCCAAGAGAGAATAGG + Intronic
1157984865 18:52425561-52425583 CTGCACAGCCAGTAGAAAATTGG + Intronic
1158949107 18:62475359-62475381 CAGCTTAGCCACAATAGAATAGG - Intergenic
1159015045 18:63094685-63094707 CTGCCTACTCAGAAGAAAATAGG + Intergenic
1167350252 19:48969733-48969755 CTGCTTAGCCAGGAGCTAAAGGG - Intronic
1167582245 19:50352050-50352072 CTCCTTAAACAGAAGAAAAGGGG + Intronic
925568079 2:5278428-5278450 CTGCAATGTCAGAAGAAAATGGG + Intergenic
927020372 2:19010476-19010498 CTGCTTAGAATGAAGAAAAGAGG + Intergenic
927232857 2:20842552-20842574 ATGCTTAGACAGAAGAAGGTTGG - Intergenic
928360867 2:30661328-30661350 CTAACTAGCCAGAAGAAACTGGG + Intergenic
928926311 2:36583228-36583250 CTGTATAACCAGAAAAAAATAGG + Intronic
929238657 2:39630999-39631021 CAGTTTTTCCAGAAGAAAATTGG - Intergenic
931889843 2:66660119-66660141 CTTATAAGCCAGAAGAAATTGGG - Intergenic
932589216 2:73053836-73053858 CTGCTTAGCTGGAGGAAATTTGG - Intronic
935185620 2:100730105-100730127 TAGCATAGCCAAAAGAAAATTGG + Intergenic
936277648 2:111114396-111114418 TTGCTTTGCCAGTAGAATATGGG - Intronic
936771285 2:115916608-115916630 CTGTTTAGCAAGAAGGTAATAGG - Intergenic
942513096 2:176723450-176723472 CAGCTCAGCCAGAATAAGATAGG + Intergenic
943352395 2:186811226-186811248 CCACTTATCCAGAAGAAATTTGG + Intergenic
943671752 2:190669527-190669549 ATGATTAGCAAAAAGAAAATGGG - Intronic
947404858 2:229764593-229764615 CTGCTAAGCCAGAAGGAAGACGG + Intronic
1170295191 20:14817177-14817199 CTGCTTAGCAACAAGTACATTGG - Intronic
1170458911 20:16558445-16558467 CTGCTTAGCCAGCGGAAGAGGGG - Intronic
1170541940 20:17398010-17398032 CTGCTTTAACAGAAGAGAATGGG - Intronic
1171081664 20:22192697-22192719 CCTCTCAGCCAGAAGAGAATGGG + Intergenic
1174810270 20:53639531-53639553 CTGATAGGCCAGGAGAAAATTGG - Intergenic
1176363857 21:6020775-6020797 GTGCAGAGCCAGAAGCAAATGGG - Intergenic
1178134657 21:29613959-29613981 CTGCTTGCCCTGAAAAAAATAGG + Intronic
1179064335 21:38010314-38010336 CTGCTTAGCTACAACAAAAGTGG - Intronic
1179759661 21:43517770-43517792 GTGCAGAGCCAGAAGCAAATGGG + Intergenic
1183315152 22:37132988-37133010 CAGCTTAGCAAGCAGAACATGGG - Intronic
1185069424 22:48647985-48648007 CTGCAAAGCCAGAAGAAGATAGG + Intronic
951570968 3:24062869-24062891 CTGCTTAGGCAGAAATAAATGGG - Intergenic
952284478 3:31955151-31955173 CTGCTCAGACAAAAGAAAAAAGG + Intronic
953700026 3:45188220-45188242 CAGCTTATCCTGAAGAACATGGG + Intergenic
957258533 3:77870443-77870465 CTGCTAAACCACAAAAAAATAGG + Intergenic
957665931 3:83226937-83226959 ATGCTTAGGTTGAAGAAAATTGG - Intergenic
957771448 3:84697368-84697390 CAGCATAGCCAACAGAAAATAGG - Intergenic
958994416 3:100886590-100886612 CTGCTTTGCAAGATGAAAGTTGG + Intronic
959471877 3:106762491-106762513 CTGATTAGTCAGAATAAATTAGG - Intergenic
961495377 3:127287654-127287676 CAGCTTTGCCTGAAGAAACTGGG - Intergenic
961770109 3:129243103-129243125 ATGCTCAGCAAGAAGAAAATTGG + Intergenic
963210678 3:142686294-142686316 CTGATTAAGCAGATGAAAATAGG - Exonic
967253612 3:187567784-187567806 CTGCTTAGCTAAAAGAAATTGGG - Intergenic
968166453 3:196469850-196469872 CTGCTATTCCAGAAAAAAATGGG - Exonic
968501914 4:954285-954307 TTCCTTATCCAAAAGAAAATAGG - Intronic
970207690 4:13671810-13671832 CTTATAAGCCAGAAGAAATTGGG + Intergenic
970320959 4:14874963-14874985 CAGCTGTGCCAGAAGAAGATGGG + Intergenic
971050772 4:22859867-22859889 CTTGTTAGCAAGTAGAAAATGGG - Intergenic
972885651 4:43483279-43483301 TTGCTAAGCCTAAAGAAAATGGG - Intergenic
973208696 4:47590287-47590309 CTGCTAAGCCACAAGGAACTTGG + Intronic
973983220 4:56324168-56324190 CTGCTCTGCCAGAAGAGAAGAGG + Exonic
974271205 4:59653374-59653396 CTACATAGCCAAAATAAAATGGG - Intergenic
974506002 4:62772787-62772809 CTACTTGGCCAGAAAAAAAATGG + Intergenic
975179324 4:71325794-71325816 ATGGTTCTCCAGAAGAAAATGGG + Intronic
975226084 4:71874164-71874186 CTGATTAGCCAAAAAAAAAGGGG - Intergenic
977193574 4:94030383-94030405 ATCCTAAGCCAAAAGAAAATTGG + Intergenic
978393955 4:108258216-108258238 CAGCTTTGCCAGAAGAGAAGAGG + Intergenic
979905228 4:126281011-126281033 TGGCTAATCCAGAAGAAAATGGG + Intergenic
979917989 4:126462879-126462901 ATGTATACCCAGAAGAAAATTGG - Intergenic
980323995 4:131316984-131317006 CTCCTTAGCAAAAAGAAAAATGG - Intergenic
981912080 4:149993611-149993633 CTGCTAAGCCAGAAGAGCATAGG + Intergenic
982197529 4:152931673-152931695 TTGCCTTGCCAGAAGTAAATAGG - Intergenic
982498286 4:156119748-156119770 CTGCATAGCAAGAAGAGAGTGGG + Intergenic
982743414 4:159081337-159081359 ATGCTTAGTAAGAAAAAAATCGG - Intergenic
982827946 4:160023702-160023724 CTGATTAGCCTCAAGAAAGTGGG + Intergenic
983166525 4:164483993-164484015 CTGCTTAGCCTGAACAAGACCGG + Intergenic
987825622 5:23026931-23026953 GTGCTTAACCAGAAGAAACCAGG - Intergenic
989309499 5:39998233-39998255 CTGCTTAGCATTGAGAAAATAGG + Intergenic
992272392 5:75078433-75078455 ATGCTTTTCCAGAAAAAAATAGG - Intronic
992314120 5:75535282-75535304 CTTATTAGCCAGAAGAGATTGGG - Intronic
992478821 5:77129884-77129906 CTGGGAAGCCAGAAAAAAATTGG + Intergenic
993031573 5:82712707-82712729 CTAATTTGCAAGAAGAAAATGGG + Intergenic
993353369 5:86877024-86877046 CAGCTGAGCCAATAGAAAATTGG + Intergenic
994277975 5:97862672-97862694 CTCCTTAGCTAGAAGCACATTGG - Intergenic
994473943 5:100243475-100243497 CTGCTTAGTCAGAAAAAAAAGGG + Intergenic
997164114 5:131640209-131640231 CTGCTTAGGCAGATAGAAATGGG - Intronic
997635897 5:135405396-135405418 CTGCCTGGCCAGAAGATATTAGG - Intergenic
1000536896 5:162490057-162490079 CTCCTTAGCAAGAGGCAAATTGG - Intergenic
1001335629 5:170794530-170794552 CTGAGTAGCAGGAAGAAAATCGG + Intronic
1004001694 6:11602287-11602309 CTGGTTAAACAGAAGAGAATGGG - Intergenic
1005657887 6:27961861-27961883 CTGCTTAATCAGAGGATAATAGG - Intergenic
1005682699 6:28222753-28222775 CTGCTAAGCAAGATGATAATAGG - Intergenic
1006050223 6:31336525-31336547 CTGCTTTCCCAGAGGAAATTAGG + Intronic
1006876036 6:37297342-37297364 CTGCTTGGCCAGAAAAACAAGGG - Intronic
1006942845 6:37764459-37764481 CTTCTTAGAAAGAAGAAAAATGG + Intergenic
1007349784 6:41261750-41261772 CTTCCTGGCCAGAAGAAAATGGG + Intergenic
1008264856 6:49412297-49412319 CTTCTTTGCCAGCAGAATATTGG - Intergenic
1010424886 6:75718598-75718620 CTACTCAGGAAGAAGAAAATGGG + Intergenic
1014066839 6:117136956-117136978 CTGCTTACCCAATGGAAAATAGG + Intergenic
1014184579 6:118420741-118420763 AGGCTTTGACAGAAGAAAATGGG - Intergenic
1015492643 6:133843963-133843985 CTGCTGAGGCAGAAGTAACTGGG - Intergenic
1016692983 6:146960504-146960526 CTGATTATTCAGAAGATAATTGG - Intergenic
1016809996 6:148251502-148251524 CTGGTCAACCTGAAGAAAATTGG + Intergenic
1017522899 6:155217573-155217595 CTGCTTACCTTGTAGAAAATGGG - Intronic
1020656539 7:10935183-10935205 CTGCTTAGTTTTAAGAAAATTGG - Intronic
1020972713 7:14966172-14966194 CTTTTTAGCCAGTAGAAAACAGG - Intronic
1021931486 7:25585626-25585648 CTGCTTGGCCACATAAAAATGGG + Intergenic
1023207973 7:37771471-37771493 CTACTTAGCCAGAAGGAAATGGG + Intronic
1023510259 7:40945249-40945271 CTGCCAAGCCAGCAGAAAAGTGG + Intergenic
1024768332 7:52687470-52687492 GTTCTTAGCCAGAAGAAAGCGGG + Intergenic
1026555475 7:71404989-71405011 CTGCAGATTCAGAAGAAAATGGG + Intronic
1027495306 7:78880389-78880411 CTGATGAGCCAGAAGAGATTGGG + Intronic
1028055993 7:86244391-86244413 CTGTTTACGGAGAAGAAAATGGG - Intergenic
1029027620 7:97433835-97433857 CTGATTGGCTATAAGAAAATAGG + Intergenic
1030513410 7:110513370-110513392 TTTCTCAGGCAGAAGAAAATTGG - Intergenic
1031133887 7:117864470-117864492 CTGTTTTGCCAGAATAGAATTGG - Intronic
1031393792 7:121247866-121247888 CTGCTTAGCCAGAAGAAAATAGG + Intronic
1033628422 7:143133422-143133444 ATGCTTTGCCCCAAGAAAATGGG + Intronic
1035032161 7:155868442-155868464 CTGTTTAGCCAGAAGGAAGAGGG + Intergenic
1035562452 8:616431-616453 CCGCTTAGCCAGGAGAGCATGGG - Intronic
1035651404 8:1268288-1268310 ATGTTTAGCAACAAGAAAATAGG - Intergenic
1035917851 8:3644495-3644517 CTGATTAGCAAAAAGAAGATGGG + Intronic
1038200038 8:25403467-25403489 CTGGTTAGCCACAAGCAAACAGG + Intronic
1040861218 8:52001277-52001299 CTGATTATCAAGAAGAAATTGGG - Intergenic
1040907999 8:52488538-52488560 CCACTTAGGCAGAAGAAAGTTGG + Intergenic
1042357242 8:67841645-67841667 CTGCTTCACCAGAAGAATAGAGG + Intergenic
1042765327 8:72315033-72315055 CTGATTAGCAAGAGGAAATTTGG + Intergenic
1042938282 8:74082298-74082320 ATGCTCAACCAGAAGAAAAATGG - Intergenic
1043177156 8:77036222-77036244 GTACCTACCCAGAAGAAAATAGG - Intergenic
1044947240 8:97400797-97400819 CTTTTTAGCCATTAGAAAATTGG + Intergenic
1046573251 8:115993070-115993092 CTCCTTTGCTAGAAAAAAATGGG - Intergenic
1046726422 8:117679377-117679399 TTGCTTAGACATAATAAAATAGG - Intergenic
1051026342 9:12616466-12616488 CATCTTATCAAGAAGAAAATTGG - Intergenic
1056811411 9:89767532-89767554 GGGCTTAGGGAGAAGAAAATAGG - Intergenic
1059260450 9:112971049-112971071 CTGCTTTCCCAGAAGAAAAATGG - Intergenic
1059884145 9:118726881-118726903 CTTATAAGCCAGAAGAAATTGGG - Intergenic
1061639654 9:131942440-131942462 CTGCTGAGTCGGAAGAAACTGGG - Intronic
1061670589 9:132186046-132186068 CAGCATAGCCAGAGAAAAATAGG + Intronic
1186504129 X:10076511-10076533 CTGCATAGACAGAGGAAGATTGG + Intronic
1187754407 X:22505452-22505474 CTGATAAACCAAAAGAAAATCGG - Intergenic
1189400041 X:40658946-40658968 CTGGTTGGCCAGAAGACAGTTGG + Intronic
1191599646 X:62989089-62989111 CTTATAAGCCAGAAAAAAATTGG - Intergenic
1194522303 X:94934243-94934265 CTGATTAGCAAGAAGAAACGTGG + Intergenic
1195311601 X:103637132-103637154 CTGCTCACCCAATAGAAAATGGG + Intergenic
1196029810 X:111084630-111084652 CTGCTTAACTAGAAAAAAAATGG - Intronic
1196247341 X:113415406-113415428 CTGCTCAGCCACAGCAAAATAGG + Intergenic
1198572170 X:137969399-137969421 ATGCTTAGACAAAAGAGAATTGG + Intergenic
1202017081 Y:20420825-20420847 CAGCTTAGCCACAACAGAATAGG - Intergenic