ID: 1031395929

View in Genome Browser
Species Human (GRCh38)
Location 7:121273631-121273653
Sequence GTTCCATTTGGTCATATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031395929 Original CRISPR GTTCCATTTGGTCATATTAA AGG (reversed) Intronic
902815536 1:18914403-18914425 GGTCCATGTGGTTAAATTAAAGG - Intronic
905066765 1:35191630-35191652 GTTCCGTTTGGTCAAAATCAAGG + Intronic
910540971 1:88356585-88356607 CTTCCAGTTGGTCATTTTATTGG - Intergenic
910702309 1:90089519-90089541 GTACCATTTGGGCATATTGGAGG + Intergenic
912945360 1:114079871-114079893 GTTGCATTTGGCCATAGAAACGG + Intergenic
919128372 1:193424483-193424505 TTTTTTTTTGGTCATATTAATGG + Intergenic
921656537 1:217745004-217745026 CTTCCAATTGGTAAGATTAATGG - Intronic
924133386 1:240936677-240936699 GCTCCATTTGGGAACATTAATGG - Exonic
1062995934 10:1866873-1866895 GTGCAATTTGGTTATATTGATGG - Intergenic
1063194305 10:3726921-3726943 TTTCCACTTGGTCATTTTTATGG + Intergenic
1063792809 10:9473786-9473808 GATACATTTGGTCAAATTCATGG + Intergenic
1065549548 10:26856959-26856981 ATTCAATCTGGTCATAGTAAAGG + Intronic
1066781092 10:38945134-38945156 GCTGCATTTAGTCTTATTAAGGG - Intergenic
1067799009 10:49344664-49344686 ATCCCATTTGGTCATGATAAAGG - Intergenic
1069304981 10:66957913-66957935 GTTGCATTTGGCCATATGTAGGG - Intronic
1072428684 10:95352276-95352298 ATTCCATGGGGTCATTTTAATGG - Intronic
1072801990 10:98398582-98398604 TTTCCATGCTGTCATATTAAAGG - Intronic
1072828096 10:98628798-98628820 GTTTCATGTGGACATATTGAGGG + Intronic
1086777790 11:90860943-90860965 GTTCTATTGGTTCATAGTAATGG - Intergenic
1087137665 11:94737128-94737150 CTTCAATTTGTTCATATAAATGG - Intronic
1093090687 12:14916992-14917014 GTTGTATTTTATCATATTAAAGG - Intronic
1095995532 12:48080544-48080566 GGTACATTTGGTTATGTTAAAGG - Intronic
1098419250 12:70274744-70274766 TTTCCATAATGTCATATTAATGG + Intronic
1105866898 13:24468883-24468905 GTTCCACTTGGTCTGAGTAAGGG - Intronic
1106807470 13:33325530-33325552 CTTCCCTTTGGTCCTATTATGGG + Intronic
1109232892 13:59780814-59780836 TTTCCTTTTGGACATGTTAATGG + Intronic
1109280511 13:60350078-60350100 GTTATATTTGGTCATCTTAAAGG - Intergenic
1109819907 13:67639053-67639075 TTTCCCTTTGGTAATATAAATGG + Intergenic
1110731657 13:78885476-78885498 GTGCCATTTGGTAATATAAAGGG - Intergenic
1111446598 13:88353579-88353601 GTTCAATTTGGTGTTCTTAAAGG - Intergenic
1111876105 13:93898156-93898178 GGATCATATGGTCATATTAATGG + Intronic
1115921152 14:38375419-38375441 GTTCCATCTAGTCTAATTAAAGG + Intergenic
1116052056 14:39816036-39816058 GTTCCATTTTGTCTTTTTCACGG + Intergenic
1116365931 14:44063216-44063238 GTTCCTTTTCCTCATAGTAAAGG - Intergenic
1119466275 14:74861403-74861425 CTTCCATTTACTCATGTTAAAGG + Intronic
1120466919 14:84869990-84870012 CTTTTATTGGGTCATATTAAAGG + Intergenic
1135918659 16:26628174-26628196 CTTCCATTTGGACCTATAAATGG - Intergenic
1137301740 16:47155692-47155714 ATTCCATTATGTAATATTAAAGG + Exonic
1139537933 16:67590354-67590376 CTCCCATTTGTTAATATTAAAGG - Intronic
1150032405 17:61753400-61753422 TTTCCATTTGGATATCTTAAAGG - Intronic
1203184403 17_KI270729v1_random:99594-99616 ATTCCATTTGATTCTATTAAAGG + Intergenic
1153244984 18:3065094-3065116 GTTTAGTTTGGTCATAATAATGG + Intergenic
1153355739 18:4133442-4133464 GGTCCATTGGGTGAAATTAATGG + Intronic
1157152450 18:45231668-45231690 TTTGCATATGGCCATATTAAAGG - Intronic
1158242585 18:55393475-55393497 GATCCATTTGATCATCATAATGG - Intronic
1159679849 18:71335816-71335838 TTACTAGTTGGTCATATTAAAGG - Intergenic
1164184621 19:22852709-22852731 ATTCGGTTTAGTCATATTAATGG + Intergenic
1164484250 19:28641203-28641225 GATCCATTTGCTGATAGTAATGG - Intergenic
930709604 2:54537834-54537856 GTTCCAGTTGGAAATATTAGGGG + Intronic
934058276 2:88270667-88270689 GTTCCATTTGGTCATTCAAGAGG + Intergenic
936048056 2:109201975-109201997 GTTTCCTTTGGACATATTACAGG - Intronic
936466483 2:112756169-112756191 GTTCCATTTGGTCTTATGCTAGG + Exonic
937006151 2:118517416-118517438 GTTCATTTTGGTCATCTTAGGGG - Intergenic
937160549 2:119757483-119757505 GTTCCATATTCTCATATCAAAGG - Intergenic
941154320 2:161957000-161957022 GTACCATCTGGACCTATTAATGG + Exonic
944320622 2:198337380-198337402 GTACAATTTGGTCAAATTATGGG + Intronic
944502092 2:200372358-200372380 GTTACATTTGGTGTCATTAAAGG - Intronic
947399531 2:229717286-229717308 GTTAGATGTGGTCATATTATTGG + Intergenic
1170367182 20:15610633-15610655 GTTCCAGGTGGGCATATTATGGG + Intronic
1173967949 20:47127965-47127987 GTTGCATTTGATAAGATTAATGG + Intronic
951785543 3:26414713-26414735 CTTCACTGTGGTCATATTAAGGG - Intergenic
952506623 3:34012617-34012639 GTTCCATGTTGTCATATGCATGG - Intergenic
952827058 3:37532700-37532722 GTTTCATTTGGTCATAAGACTGG + Intronic
953573562 3:44093902-44093924 CTTCCATTTGGTGATTTTGAGGG - Intergenic
953777507 3:45833654-45833676 ATTCCTTTGGGTCATATTTATGG - Intronic
954923215 3:54209702-54209724 GTTCCCTTGGATTATATTAATGG + Intronic
957879549 3:86193503-86193525 GTTCTATTTGTACACATTAAGGG - Intergenic
958806506 3:98817562-98817584 GTTCCTTTTGGTGATTGTAACGG - Intronic
960426924 3:117520212-117520234 GTTCCACTTGGTCCTATAAAAGG - Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
964795275 3:160489980-160490002 GTTCCAGATTGTCATATAAATGG + Intergenic
974452163 4:62079063-62079085 GTTCCATTTTGTCATATTATTGG - Intergenic
975201156 4:71591323-71591345 GTTCCAATTAGTAAAATTAATGG - Intergenic
975788622 4:77922856-77922878 GTTCCATTTGGACATCTAAAAGG - Intronic
978630008 4:110733296-110733318 CTACCATTTGGAAATATTAAGGG - Intergenic
978852770 4:113357965-113357987 GGACCTTTTGGTCATATCAATGG - Exonic
979466910 4:121050006-121050028 GTTCAATTTGGTCAGGTTACAGG + Intronic
981357053 4:143800927-143800949 GTTCCATCCATTCATATTAAGGG - Intergenic
982560387 4:156922517-156922539 GTGCCATTTTGTCATACTAGAGG - Intronic
982625690 4:157763293-157763315 TTTTCTTTTGTTCATATTAAAGG - Intergenic
983850405 4:172573017-172573039 GTTCTATTTAGTGATATTATGGG - Intronic
984150176 4:176120052-176120074 GTTGTGTTTGGTCATATTGATGG + Exonic
986635474 5:9818226-9818248 GGCTCATTTGGCCATATTAAGGG + Intergenic
988423434 5:31034460-31034482 TTTCTATTTTGCCATATTAAAGG - Intergenic
995254395 5:110029720-110029742 CTTCCAGATGGTCAAATTAAAGG - Intergenic
997279225 5:132628446-132628468 CTTCCATTTTGTCAAATTTAAGG - Intronic
999522762 5:152369152-152369174 GTTTCATTTTGTCAAATTAAGGG - Intergenic
1004912523 6:20300705-20300727 GTTCCACTCGGTCATGTTGAAGG - Intergenic
1008055606 6:46942538-46942560 GTGCAATTTTCTCATATTAAAGG + Intronic
1009389728 6:63131268-63131290 GTTTTATTTGGTAATATTTAGGG - Intergenic
1010467035 6:76180118-76180140 GTTCCATTGGCCCATAGTAACGG - Intergenic
1012763911 6:103339771-103339793 CTGCCATTTGTTCATATTTATGG + Intergenic
1013788649 6:113811357-113811379 ACTCCATTAGATCATATTAATGG + Intergenic
1013908771 6:115249177-115249199 GTTCCATGTATTCATATTCAAGG - Intergenic
1014151778 6:118065153-118065175 GTTCCATGTGATCACATTAATGG - Intronic
1014258275 6:119186154-119186176 ATTCCAATTGGTAATATTGAAGG - Intronic
1014703674 6:124720777-124720799 GTTCCATTTGGTGAAAAGAATGG + Intronic
1016404788 6:143718661-143718683 GTTATGTTTGGTCCTATTAAAGG + Intronic
1021395855 7:20147368-20147390 ATTACATTTTGTCACATTAAAGG + Intronic
1021738100 7:23658713-23658735 GTTCGATTTGATCTTATAAAAGG - Intergenic
1024615294 7:51106710-51106732 GTTCCACTTGGTAAAATGAAAGG + Intronic
1030809179 7:113954995-113955017 ATTCCATTTGGTGACATTGAAGG + Intronic
1031395929 7:121273631-121273653 GTTCCATTTGGTCATATTAAAGG - Intronic
1034008853 7:147506176-147506198 GCTCCATTTCCTCATATTGATGG - Intronic
1037358710 8:18050968-18050990 ATTCCATTTGGTAATATGTATGG + Intergenic
1043991193 8:86757168-86757190 TTTCTCTTTGGTCAAATTAAGGG + Intergenic
1044802320 8:95970255-95970277 CTTGCATTTGGTCACATTAGTGG - Intergenic
1045139037 8:99258725-99258747 ATTCCATTTTGTCATATTTATGG + Intronic
1050719630 9:8571703-8571725 CTTCCATTTGTTCATTTTAAGGG + Intronic
1050810006 9:9732949-9732971 GTTCCTTTTGTTCATATTTATGG + Intronic
1055676322 9:78665609-78665631 GTTCCCATGGGTCATATTGATGG + Intergenic
1057734171 9:97638292-97638314 GTTCATTTTGGCTATATTAAAGG - Intronic
1058806363 9:108595897-108595919 GATCCATTTGTTCATAGTGACGG - Intergenic
1060457784 9:123816698-123816720 ATTGCATTTGGTCCTATTCAAGG - Intronic
1060767560 9:126306559-126306581 GTTCCATTTGGAGATCTCAAGGG - Intergenic
1203624568 Un_KI270750v1:872-894 TTTCCTTTTAGTCATATTTATGG - Intergenic
1186177829 X:6943976-6943998 CTTCCATTTGGTCATTTTTGTGG + Intergenic
1187018504 X:15354670-15354692 TTTCCATTTGGTAATCTTAAGGG + Intronic
1188682372 X:33026550-33026572 CTGCCATTTTGTAATATTAATGG - Intronic
1194077230 X:89411235-89411257 TTTCCATTTGGTTGTTTTAAAGG + Intergenic
1196962320 X:121016489-121016511 GTTCCAGTAGTTCATCTTAATGG - Intergenic
1196993183 X:121350385-121350407 GTTACATTTCGGCATATTTAAGG - Intergenic
1201383426 Y:13412304-13412326 ATCCCATTTTGTCATATTACTGG - Intronic