ID: 1031398270

View in Genome Browser
Species Human (GRCh38)
Location 7:121300270-121300292
Sequence GGCTGCACTGCATTCAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031398270_1031398272 -6 Left 1031398270 7:121300270-121300292 CCAACACTGAATGCAGTGCAGCC No data
Right 1031398272 7:121300287-121300309 GCAGCCGAGGATAGTCCATGAGG No data
1031398270_1031398277 23 Left 1031398270 7:121300270-121300292 CCAACACTGAATGCAGTGCAGCC No data
Right 1031398277 7:121300316-121300338 ATGGTCTGTGCAGGATTGAAAGG No data
1031398270_1031398276 14 Left 1031398270 7:121300270-121300292 CCAACACTGAATGCAGTGCAGCC No data
Right 1031398276 7:121300307-121300329 AGGTACATCATGGTCTGTGCAGG No data
1031398270_1031398274 4 Left 1031398270 7:121300270-121300292 CCAACACTGAATGCAGTGCAGCC No data
Right 1031398274 7:121300297-121300319 ATAGTCCATGAGGTACATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031398270 Original CRISPR GGCTGCACTGCATTCAGTGT TGG (reversed) Intergenic
No off target data available for this crispr