ID: 1031401516

View in Genome Browser
Species Human (GRCh38)
Location 7:121329826-121329848
Sequence TGGGTCCTTAGGGGTTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 221}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031401497_1031401516 30 Left 1031401497 7:121329773-121329795 CCCCGATGGGCGCCAGCCCCCTC 0: 1
1: 0
2: 1
3: 6
4: 159
Right 1031401516 7:121329826-121329848 TGGGTCCTTAGGGGTTGGTGGGG 0: 1
1: 0
2: 1
3: 19
4: 221
1031401504_1031401516 12 Left 1031401504 7:121329791-121329813 CCCTCTTTGGCTACGAGCTGAGC 0: 1
1: 0
2: 0
3: 6
4: 47
Right 1031401516 7:121329826-121329848 TGGGTCCTTAGGGGTTGGTGGGG 0: 1
1: 0
2: 1
3: 19
4: 221
1031401503_1031401516 13 Left 1031401503 7:121329790-121329812 CCCCTCTTTGGCTACGAGCTGAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1031401516 7:121329826-121329848 TGGGTCCTTAGGGGTTGGTGGGG 0: 1
1: 0
2: 1
3: 19
4: 221
1031401499_1031401516 28 Left 1031401499 7:121329775-121329797 CCGATGGGCGCCAGCCCCCTCTT 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1031401516 7:121329826-121329848 TGGGTCCTTAGGGGTTGGTGGGG 0: 1
1: 0
2: 1
3: 19
4: 221
1031401498_1031401516 29 Left 1031401498 7:121329774-121329796 CCCGATGGGCGCCAGCCCCCTCT 0: 1
1: 0
2: 0
3: 21
4: 185
Right 1031401516 7:121329826-121329848 TGGGTCCTTAGGGGTTGGTGGGG 0: 1
1: 0
2: 1
3: 19
4: 221
1031401501_1031401516 18 Left 1031401501 7:121329785-121329807 CCAGCCCCCTCTTTGGCTACGAG 0: 1
1: 0
2: 2
3: 2
4: 71
Right 1031401516 7:121329826-121329848 TGGGTCCTTAGGGGTTGGTGGGG 0: 1
1: 0
2: 1
3: 19
4: 221
1031401502_1031401516 14 Left 1031401502 7:121329789-121329811 CCCCCTCTTTGGCTACGAGCTGA 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1031401516 7:121329826-121329848 TGGGTCCTTAGGGGTTGGTGGGG 0: 1
1: 0
2: 1
3: 19
4: 221
1031401505_1031401516 11 Left 1031401505 7:121329792-121329814 CCTCTTTGGCTACGAGCTGAGCA 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1031401516 7:121329826-121329848 TGGGTCCTTAGGGGTTGGTGGGG 0: 1
1: 0
2: 1
3: 19
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031401516 Original CRISPR TGGGTCCTTAGGGGTTGGTG GGG Intronic