ID: 1031402818

View in Genome Browser
Species Human (GRCh38)
Location 7:121345760-121345782
Sequence ATTTAAAAGCAAATGATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031402818_1031402824 22 Left 1031402818 7:121345760-121345782 CCAACCATCATTTGCTTTTAAAT No data
Right 1031402824 7:121345805-121345827 ACTCACAATGCATACTCCTTGGG No data
1031402818_1031402820 -5 Left 1031402818 7:121345760-121345782 CCAACCATCATTTGCTTTTAAAT No data
Right 1031402820 7:121345778-121345800 TAAATCTCTCCTCTTCTCAGAGG No data
1031402818_1031402823 21 Left 1031402818 7:121345760-121345782 CCAACCATCATTTGCTTTTAAAT No data
Right 1031402823 7:121345804-121345826 GACTCACAATGCATACTCCTTGG No data
1031402818_1031402821 -1 Left 1031402818 7:121345760-121345782 CCAACCATCATTTGCTTTTAAAT No data
Right 1031402821 7:121345782-121345804 TCTCTCCTCTTCTCAGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031402818 Original CRISPR ATTTAAAAGCAAATGATGGT TGG (reversed) Intergenic
No off target data available for this crispr