ID: 1031403421

View in Genome Browser
Species Human (GRCh38)
Location 7:121353634-121353656
Sequence GGAGTCTGGTATTTTGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031403421 Original CRISPR GGAGTCTGGTATTTTGCAAC AGG Intronic
901427777 1:9193627-9193649 GGGACCTGGGATTTTGCAACAGG + Intergenic
906966715 1:50464533-50464555 AGAGTCTGTTATAATGCAACTGG + Intronic
911498109 1:98655100-98655122 TGAGTCTGATAGTTTCCAACAGG - Intergenic
911763491 1:101644099-101644121 GGAGTCTGGTATTTCAGGACAGG - Intergenic
912938826 1:114027017-114027039 GGAGTCTGGAAGTCTGAAACTGG + Intergenic
920406678 1:205719375-205719397 AGGGTCTTGTATTCTGCAACTGG - Intronic
920452154 1:206067647-206067669 GGAGTGAGGTATTTGGGAACAGG - Intronic
922947262 1:229527378-229527400 TGAGTCTGGAATTTTCCCACCGG - Intronic
923125468 1:231030679-231030701 GAAGTCTGCTATTTTATAACAGG - Intronic
924251906 1:242141298-242141320 GGAGCCTGGCATTTTACAGCGGG - Intronic
1064134400 10:12737859-12737881 GGAGTCTCATATTATACAACTGG - Intronic
1065511802 10:26486615-26486637 GGAATCTGGAATTTTGGACCTGG - Intronic
1065941938 10:30572818-30572840 GGAGTAAGGTATTTGGGAACAGG - Intergenic
1068789904 10:61016937-61016959 GGAGACTGAAAATTTGCAACTGG - Intergenic
1069610434 10:69769101-69769123 TGAGTCTGGTAGTTTGCTGCTGG + Intergenic
1069632293 10:69904341-69904363 TGAGTCTGGTCTATTGCAATTGG - Intronic
1072147481 10:92655050-92655072 GGACTCTGGTATTTTTGATCTGG + Exonic
1080223390 11:29933411-29933433 GGATTCTGGGATTCTACAACAGG - Intergenic
1081649423 11:44813725-44813747 AGAGGCTGTTATTTTGCAAGAGG + Intronic
1084224362 11:67706433-67706455 GGAGTCTGGCATGGTGCAGCCGG + Intergenic
1085815197 11:79730084-79730106 AGTGTCTGGTATTTTGAAAGTGG - Intergenic
1088187885 11:107193716-107193738 GCAGACTGGGATTTTCCAACAGG + Intergenic
1088349588 11:108870647-108870669 GGAGGTTGCTATTTTGCATCAGG - Intronic
1089316261 11:117593301-117593323 GGAATCTGCCATTTTGCAAGAGG - Intronic
1089764751 11:120755070-120755092 GGACTCTGGTAATTTGGAATGGG + Intronic
1090043832 11:123313869-123313891 GCAGTCTGGTATTTGGCATATGG + Intergenic
1095040005 12:37430878-37430900 GGTGTCTGCTCTTTTGCAATTGG - Intergenic
1096421605 12:51463373-51463395 GGAGTCAGGTACTATGGAACAGG + Intronic
1102275009 12:111575198-111575220 GCAGTCTGGTATGTTGCTAAGGG - Intronic
1103673502 12:122637732-122637754 GCAGTGTGGCAATTTGCAACTGG - Intergenic
1104060374 12:125262939-125262961 GGAGGCTGGTTTATTGCATCTGG - Intronic
1104783699 12:131436698-131436720 AGATTCTGACATTTTGCAACAGG + Intergenic
1111166843 13:84469456-84469478 TGTGTCTGGTATTTTTCAATTGG - Intergenic
1111388223 13:87557482-87557504 GGAGTCTGATGTTTTCCAGCAGG - Intergenic
1112065115 13:95784570-95784592 GGAGTCTGGGATTTTGGTGCAGG - Intronic
1114227814 14:20754844-20754866 AGCATCTGGAATTTTGCAACTGG - Intergenic
1117073675 14:52079222-52079244 GGAGTCAGGTATTGTGCTAGGGG - Intergenic
1119969852 14:78958118-78958140 GGACTCTGGTATTTGAAAACAGG + Intronic
1121243325 14:92445592-92445614 ACAGTATGGTATTTTGCAAAGGG + Intronic
1121396767 14:93631430-93631452 GGAGGCGAGTATTTTGAAACTGG + Intronic
1129713125 15:77831568-77831590 GGAGGCTGGTTTTTTAGAACTGG - Intergenic
1132952142 16:2569125-2569147 GGAATCTGGTATTTGGCACAGGG + Intronic
1132962208 16:2631045-2631067 GGAATCTGGTATTTGGCACAGGG - Intergenic
1133256198 16:4517935-4517957 GGAGTCTGGGAGTTTGTAGCAGG - Intronic
1134911005 16:18026356-18026378 AGAGTGTGGCATTTTGCCACGGG + Intergenic
1135021957 16:18970309-18970331 GGTGTCTGTTTTTTTGAAACAGG + Intergenic
1138083574 16:54114562-54114584 GGAGTCAGGGAATGTGCAACAGG + Exonic
1151045164 17:70911442-70911464 GGAGTCTGTCCTTTTGCAGCTGG - Intergenic
1153310018 18:3668572-3668594 GGAGTCCAGTATTTTGCCAAAGG - Intronic
1154297376 18:13162547-13162569 TAAGTCTGTCATTTTGCAACCGG - Intergenic
1156043866 18:32856337-32856359 AGGGTCAGGTATTTTGCCACAGG + Intergenic
1156435240 18:37119879-37119901 GGAGAATGGTATTTAGAAACTGG - Intronic
1157770195 18:50338982-50339004 GGAGTCTGGCCTGTTGGAACTGG + Intergenic
1158025958 18:52897809-52897831 GGAGTCTGTAATTTTGCCAGTGG + Intronic
1159766492 18:72496424-72496446 GAAATCTGTTATTTTGCTACTGG - Intergenic
930094239 2:47554643-47554665 AGAGTCAGATTTTTTGCAACAGG + Intronic
932075334 2:68657034-68657056 GGAGTTTGGTATTTTGGAGTTGG + Intergenic
933770075 2:85738028-85738050 TGAGTCTGGTTTTCTGCTACAGG + Intergenic
934887513 2:98037927-98037949 GGGGTTTGGTGCTTTGCAACTGG - Intergenic
938767099 2:134467558-134467580 GGAGTCGGGTATTTTGTAGACGG - Intronic
941085411 2:161111848-161111870 ATAGTTTAGTATTTTGCAACAGG - Intergenic
944645423 2:201775428-201775450 AGAGTCTGGTATTTTACACATGG + Intronic
946771525 2:223093435-223093457 GGAGTCTGTGATTTTCCATCTGG + Intronic
1171792566 20:29541432-29541454 GGTGTCTGCTCTTTTGCAATTGG + Intergenic
1171837555 20:30171037-30171059 GCTGTCTGTTCTTTTGCAACTGG - Intergenic
1171855907 20:30342951-30342973 GGTGTCTGCTCTTTTGCAATTGG - Intergenic
1172617259 20:36297600-36297622 GGAGCCAGGTATTTTGCTTCAGG - Intergenic
1173760989 20:45560404-45560426 GAAGTCTGGCATTGTGCATCTGG - Intronic
1179193666 21:39144635-39144657 GGAGGCTGGCATTCTGGAACAGG + Intergenic
1183169144 22:36172160-36172182 GGAGTGAGGTATTTGGGAACAGG + Intergenic
956191718 3:66614354-66614376 GGACTCTGCTCTTTTGCTACTGG - Intergenic
956730544 3:72192895-72192917 TGAGTCAGGTATTTTGCTAAGGG - Intergenic
959858679 3:111191714-111191736 AGAGTCTGATATTTTGAATCAGG - Intronic
959874223 3:111362959-111362981 GAAGTCTGATATTATGCACCAGG - Intronic
962703303 3:138019800-138019822 GAATTAAGGTATTTTGCAACAGG + Intronic
964026660 3:152082092-152082114 GGTATCTAGTATTCTGCAACAGG - Intergenic
965750245 3:171968397-171968419 GGAGTCTGGAATAGTGCAATGGG + Intergenic
971240375 4:24883102-24883124 GGAGCCTTGTTCTTTGCAACTGG - Intronic
971490571 4:27208100-27208122 GGATGCTGGTTTTTTGGAACTGG + Intergenic
971670076 4:29545079-29545101 GGACTATGGTATTTTGTTACAGG + Intergenic
976801943 4:89002841-89002863 AGAGTATGGTGTTTTGCAAGAGG + Intronic
983614120 4:169682830-169682852 GGAGTCAGCAATTTTGCCACTGG + Intronic
984471244 4:180177147-180177169 AGATTCTGGTATGTTGAAACAGG - Intergenic
984986232 4:185332500-185332522 GGAATGTAGTATTTTGCAACAGG + Intronic
985580259 5:692427-692449 GGAGGCTGCTATTTTGATACGGG - Intronic
987957284 5:24756431-24756453 GAAGTCATGTATTTTGCAACTGG - Intergenic
989167363 5:38445156-38445178 GGGGTCTGGAATCTTGCAATGGG + Intronic
991407400 5:66314238-66314260 GGACTCTGTTAATTTCCAACAGG - Intergenic
994455230 5:99997352-99997374 GGAGTCTGGTGTTCTGAAACTGG + Intergenic
1003837574 6:10088066-10088088 GGTGTGTGGTATTTTTCACCAGG + Intronic
1004078453 6:12367388-12367410 GGAAATTGGTATTTTGCAAAGGG + Intergenic
1004582557 6:16968261-16968283 GGAGTCCTGTATTTTGCACTGGG - Intergenic
1007684477 6:43657070-43657092 GGATTCTGGTATTTAGGGACTGG + Intronic
1021442885 7:20698930-20698952 AGAGTCTGGGATTTTGCTAAAGG + Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1023442262 7:40196504-40196526 TGAGTCTGGTAGTTGGCAAGGGG + Intronic
1025286065 7:57662517-57662539 GGTGTCTGCTCTTTTGCAATTGG - Intergenic
1027692763 7:81369062-81369084 GGAGTCTGATATTTGACAGCAGG - Intergenic
1028545448 7:91993912-91993934 TGAGTCTGGTAGTTTGAGACTGG + Intronic
1031144420 7:117981764-117981786 AGACTCTGTTATTTTGAAACAGG - Intergenic
1031403421 7:121353634-121353656 GGAGTCTGGTATTTTGCAACAGG + Intronic
1033128816 7:138727931-138727953 TGAACCTGGTATTTGGCAACAGG + Intronic
1036167068 8:6445419-6445441 GGAGTTTGATATTTTGGAAGTGG - Exonic
1038336959 8:26653213-26653235 GGACTCTTGTGTTTTGCAGCTGG + Exonic
1044653350 8:94522337-94522359 GGACTCTGGAAGCTTGCAACTGG + Intronic
1046802861 8:118448242-118448264 GGAGTCTTGCATTTTTAAACAGG - Intronic
1049321226 8:141997624-141997646 GGAGCCTGGAGTTTTGCCACAGG - Intergenic
1052050507 9:23842422-23842444 GGAGGCTGGTTTTCTGCAACAGG - Intergenic
1055697344 9:78900261-78900283 GGAGTTTGGTATGTTCTAACAGG - Intergenic
1056007640 9:82289626-82289648 GGATTCTGGTATTTTCCTGCTGG - Intergenic
1059250120 9:112880683-112880705 GGAGTCTGTTACTGTGCAATGGG + Intronic
1186276802 X:7948349-7948371 TGAGGCTGTTATTTTGCACCTGG + Intergenic
1187221585 X:17331725-17331747 GGAGTCTGATGTTTGGCAGCAGG + Intergenic
1193758449 X:85437074-85437096 GGAGTATTGTATTTTGCAACGGG + Intergenic
1196188404 X:112769522-112769544 GGAGTCTGTTATGTAGCAAGGGG + Intergenic
1197640962 X:128967657-128967679 GGATTCTGGGATTTGGCACCAGG - Intergenic
1199391978 X:147290751-147290773 GGAGTGAGGTAATGTGCAACAGG - Intergenic
1199785844 X:151104033-151104055 AGAGTGTGATGTTTTGCAACTGG - Intergenic
1199815017 X:151389404-151389426 GGAGTCACTTATTTTTCAACAGG - Intergenic
1201325759 Y:12756014-12756036 GGAGTGATGTTTTTTGCAACGGG + Intronic