ID: 1031406732

View in Genome Browser
Species Human (GRCh38)
Location 7:121395965-121395987
Sequence CGCAGGCGGGACTGGGGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 266}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031406732_1031406744 13 Left 1031406732 7:121395965-121395987 CCGGGACCCCAGTCCCGCCTGCG 0: 1
1: 0
2: 1
3: 17
4: 266
Right 1031406744 7:121396001-121396023 CCGGACACGCCGTGACAACGCGG 0: 1
1: 0
2: 0
3: 0
4: 9
1031406732_1031406750 25 Left 1031406732 7:121395965-121395987 CCGGGACCCCAGTCCCGCCTGCG 0: 1
1: 0
2: 1
3: 17
4: 266
Right 1031406750 7:121396013-121396035 TGACAACGCGGCCGGGCCCGGGG 0: 1
1: 0
2: 1
3: 6
4: 59
1031406732_1031406749 24 Left 1031406732 7:121395965-121395987 CCGGGACCCCAGTCCCGCCTGCG 0: 1
1: 0
2: 1
3: 17
4: 266
Right 1031406749 7:121396012-121396034 GTGACAACGCGGCCGGGCCCGGG 0: 1
1: 0
2: 1
3: 10
4: 66
1031406732_1031406739 -6 Left 1031406732 7:121395965-121395987 CCGGGACCCCAGTCCCGCCTGCG 0: 1
1: 0
2: 1
3: 17
4: 266
Right 1031406739 7:121395982-121396004 CCTGCGCCCTCTCCAACGTCCGG 0: 1
1: 0
2: 0
3: 6
4: 112
1031406732_1031406745 17 Left 1031406732 7:121395965-121395987 CCGGGACCCCAGTCCCGCCTGCG 0: 1
1: 0
2: 1
3: 17
4: 266
Right 1031406745 7:121396005-121396027 ACACGCCGTGACAACGCGGCCGG 0: 1
1: 0
2: 0
3: 0
4: 9
1031406732_1031406748 23 Left 1031406732 7:121395965-121395987 CCGGGACCCCAGTCCCGCCTGCG 0: 1
1: 0
2: 1
3: 17
4: 266
Right 1031406748 7:121396011-121396033 CGTGACAACGCGGCCGGGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 73
1031406732_1031406746 18 Left 1031406732 7:121395965-121395987 CCGGGACCCCAGTCCCGCCTGCG 0: 1
1: 0
2: 1
3: 17
4: 266
Right 1031406746 7:121396006-121396028 CACGCCGTGACAACGCGGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031406732 Original CRISPR CGCAGGCGGGACTGGGGTCC CGG (reversed) Intronic
900189219 1:1346236-1346258 GGCAGGCGGCCCTGGGGACCAGG + Intronic
900244117 1:1629856-1629878 AGCAGGCGGGGCTGGGGGCTGGG - Intronic
900429234 1:2594123-2594145 AGGAGGCCGGACTGAGGTCCTGG - Intronic
900436967 1:2635387-2635409 GGCAGGTGGGACGGGGGTCAGGG + Intergenic
900490905 1:2948706-2948728 GGCAGGAGGCACTGGGGTCCTGG - Intergenic
900558084 1:3289991-3290013 CCCAGGCAGGAGTGGGGTCCTGG - Intronic
900763913 1:4491224-4491246 CACAGGCAGGACTGGGGGCTTGG - Intergenic
901600430 1:10419431-10419453 GGCAGTCAGCACTGGGGTCCAGG + Exonic
901637290 1:10676239-10676261 AGCATGGGGGACGGGGGTCCGGG - Intronic
901643560 1:10705041-10705063 CGAAGGCAGGACTGGGGTTCTGG + Intronic
902286130 1:15409845-15409867 CGAAGGTGGGACTTGGGCCCTGG - Intergenic
902920622 1:19664639-19664661 CGCAGGCGGAACTGGGAGCAGGG - Intergenic
903029695 1:20454915-20454937 CACAGACAGGACTGGGGCCCTGG - Intergenic
903514488 1:23901506-23901528 CACCAACGGGACTGGGGTCCAGG - Intronic
903691246 1:25175165-25175187 CTCAGGAGGGCCTGGGCTCCCGG + Intergenic
903807774 1:26017682-26017704 GGCAGGCAGGACTGAGGTCAGGG - Intergenic
905259219 1:36705823-36705845 AGCAGGCGGCACCCGGGTCCAGG + Intergenic
905442732 1:38005391-38005413 CGCAGGCGGGGCCGGGAACCGGG + Exonic
906262809 1:44406635-44406657 CGGTGGCGGGGCTGGGTTCCGGG - Intronic
906507989 1:46394235-46394257 CGCAGGCGGGCGTGGGATCCCGG + Intergenic
908714201 1:67053415-67053437 CGCAGCCTGGACAGGGGGCCGGG - Intronic
912466610 1:109878998-109879020 AGCAGGTGGGAGTTGGGTCCTGG + Intergenic
914197331 1:145454417-145454439 GGCCGGCGGGGCGGGGGTCCCGG - Intergenic
915343995 1:155189949-155189971 CCGGGGCGGGACTGGTGTCCGGG + Intronic
915367599 1:155324445-155324467 CGCAGGCAGGACTGGGCCCCGGG + Intronic
921034011 1:211359163-211359185 CCCAGGCTGGACTTGAGTCCTGG + Intronic
922079078 1:222277096-222277118 CCCAGGCTGGTCTGGAGTCCTGG - Intergenic
922189256 1:223302687-223302709 CCCAGGCAGCCCTGGGGTCCGGG - Intronic
922706928 1:227795044-227795066 CACAGGCGGGGCTGGGCCCCAGG + Intergenic
922817804 1:228463388-228463410 TGCAGGCCTGACTGGGGCCCAGG - Intergenic
924503014 1:244653719-244653741 GGCGGTCGGGACGGGGGTCCCGG - Intronic
924772076 1:247087670-247087692 GGCAGGCTGGACTTGGGGCCAGG + Intergenic
1063096484 10:2913253-2913275 TGCACGCGGGACAGGGGACCCGG + Intergenic
1066126553 10:32347534-32347556 GGCAGGCGGGGCTCGGGCCCCGG + Intronic
1067179461 10:43973866-43973888 GGCAGGCTGGGCTGGAGTCCAGG - Intergenic
1067205548 10:44209075-44209097 CACTGGGGAGACTGGGGTCCTGG - Intergenic
1067945299 10:50685130-50685152 GGCAGGTGGGTCTGTGGTCCTGG - Intergenic
1069068973 10:63974846-63974868 GGCAGACAGGACTGGGGCCCTGG - Intergenic
1069827853 10:71265323-71265345 ACCTGGCGGGACTGGGGGCCCGG + Intronic
1069861269 10:71473156-71473178 CCCAGGCGGGAATGGAGGCCAGG - Intronic
1070866809 10:79712002-79712024 GGCAGGTGGGTCTGTGGTCCTGG - Exonic
1070880599 10:79850123-79850145 GGCAGGTGGGTCTGTGGTCCTGG - Exonic
1071633721 10:87234225-87234247 GGCAGGTGGGTCTGTGGTCCTGG - Exonic
1071647169 10:87366441-87366463 GGCAGGTGGGTCTGTGGTCCTGG - Exonic
1073057928 10:100714003-100714025 CGGAGGTGGGACTGGGGAGCAGG + Intergenic
1073441785 10:103556532-103556554 CGCAGCCGGAACTGGTGACCAGG + Intronic
1075090632 10:119442311-119442333 CACAGGTGGGGCTGGGGGCCTGG - Intronic
1075713343 10:124542421-124542443 AGCAGGTGGGACTTGGGCCCTGG + Intronic
1075727210 10:124616732-124616754 CGCATGCGGGGCTGGAGTTCGGG + Intronic
1076986000 11:236409-236431 CGGAGGCGGGGCTGGGGCGCCGG - Exonic
1076986020 11:236448-236470 CGGAGGCGGGACCGGGGCGCCGG - Intronic
1077010361 11:376736-376758 CGCACGCGGCGCTGGGGCCCGGG - Exonic
1077271797 11:1684976-1684998 CCCAGGAGGGAAGGGGGTCCAGG + Intergenic
1077500887 11:2909361-2909383 GGCCGGGGGGACTGGAGTCCAGG + Intronic
1079604051 11:22343373-22343395 GCCAGGCGGGACTGGGGCTCGGG + Intronic
1083750610 11:64758777-64758799 GGCAGGCGGGCCAGAGGTCCAGG - Intronic
1084118849 11:67057144-67057166 CCCAGCGGGGCCTGGGGTCCAGG + Intronic
1084755646 11:71236957-71236979 CGCAGGTGGGACTGCGCTGCGGG + Intronic
1084758373 11:71252726-71252748 CGCGGGCGGGAGCGGGGTCGGGG - Intergenic
1085082451 11:73646207-73646229 CGCAGCCAGGACTGGGGTGATGG + Exonic
1086663897 11:89456606-89456628 CGCAGGAGTTGCTGGGGTCCAGG - Intronic
1089307928 11:117538437-117538459 CGCAGGAGGCGCTGGGGGCCCGG - Intronic
1089605513 11:119639030-119639052 CCCAAGCTGGGCTGGGGTCCGGG - Intronic
1090345034 11:126062776-126062798 GGCGGGCGGGCGTGGGGTCCCGG + Intronic
1090857826 11:130625754-130625776 CCCAGGCGGGACTGGGGCTCCGG - Intergenic
1094828042 12:34287310-34287332 CACAGGAGAGAATGGGGTCCTGG + Intergenic
1094828675 12:34289950-34289972 CGCAGTCGAGACTGGGGGCCTGG - Intergenic
1096498399 12:52051498-52051520 CGCACGCGGGACCAGGGACCAGG + Intronic
1096615779 12:52832780-52832802 CAGAGGCGGGACTGGGACCCAGG - Intronic
1102945874 12:116987481-116987503 CGCAGTCAGGACTGGGGAGCGGG + Intronic
1103455811 12:121064372-121064394 CACATGTGGGACTGGGATCCGGG + Intergenic
1104207705 12:126656278-126656300 GGCAGCCTGGACTGGGGGCCTGG + Intergenic
1104854341 12:131894977-131894999 CGCAGGCGGGCCGGGGGCGCGGG - Exonic
1106361908 13:29038908-29038930 TGCGGGCGGGCCTGGGGTGCCGG + Intronic
1113747309 13:112754314-112754336 CAGAGGTGGGACTGGGGACCAGG - Intronic
1114063258 14:19038518-19038540 GCCCGGCGGGACTGAGGTCCTGG + Intergenic
1114098997 14:19361477-19361499 GCCCGGCGGGACTGAGGTCCTGG - Intergenic
1114658676 14:24331264-24331286 TGCAGGCAGGACAGGGGTCACGG - Exonic
1115331245 14:32201276-32201298 CGCAGGCGCCTCTGGGGTCAGGG - Intergenic
1116928717 14:50668424-50668446 CGGCGGCGGGACTCGGGTGCCGG + Intergenic
1117029299 14:51652091-51652113 CGGCGGCGGGACTGGGTTTCGGG + Intronic
1118053779 14:62057076-62057098 AGCAGGCAGAACTGGGCTCCTGG - Intronic
1118866188 14:69705546-69705568 TGCAGCCGGGACTGGGAACCAGG - Intronic
1120437011 14:84494887-84494909 TGCACACGGGAATGGGGTCCTGG - Intergenic
1122061646 14:99140153-99140175 CTCAGACTGGGCTGGGGTCCAGG + Intergenic
1122234349 14:100323491-100323513 AGCAGGAGGAACTGAGGTCCAGG + Intronic
1122548407 14:102537498-102537520 CACAGGGGGGTCTGGGGCCCAGG + Intergenic
1122790693 14:104183035-104183057 GGCAGGGAGGACCGGGGTCCAGG - Intergenic
1122993634 14:105250615-105250637 CACCAACGGGACTGGGGTCCAGG + Exonic
1128276344 15:66356803-66356825 CGAAGGCGGGACCGGCGTGCTGG - Intronic
1128783832 15:70380185-70380207 AGCTGGGGGGACTTGGGTCCTGG + Intergenic
1129452720 15:75659783-75659805 CTCAGGAGGGACTTGGATCCAGG + Exonic
1129476766 15:75791035-75791057 AGGAGGCGGGGATGGGGTCCTGG + Intergenic
1130462095 15:84167299-84167321 AGCAGGCGGGGATGGGGTCATGG + Intergenic
1130490582 15:84427474-84427496 AGCAGGCGGGGATGGGGTCATGG - Intergenic
1130502170 15:84506244-84506266 AGCAGGCGGGGATGGGGTCATGG - Intergenic
1131423530 15:92326834-92326856 CTCAGGCAGGACTGGGCACCGGG - Intergenic
1132665302 16:1078750-1078772 GGCAGGCGGGGCTGGGGCCCAGG + Intergenic
1132681525 16:1144396-1144418 CCCAGCCGGGCCTGGGGTACAGG + Intergenic
1132696865 16:1205875-1205897 CCCAGGGGGCACTGGGGGCCGGG + Intronic
1133234286 16:4380583-4380605 GGCAGGAGGGCCTGGGGTTCAGG + Intronic
1133287697 16:4698240-4698262 CCCAGGCAGGAGTTGGGTCCGGG - Intronic
1136278414 16:29192750-29192772 TGCAGACAGGACTGGGGTCTGGG + Intergenic
1140025795 16:71289334-71289356 CGGAGGTGGGACTGGCTTCCCGG - Exonic
1141093774 16:81148399-81148421 GGCAGAAGGGACTGGGCTCCGGG - Intergenic
1141687152 16:85577059-85577081 CACAGTCAGGACTTGGGTCCTGG + Intergenic
1141734460 16:85843063-85843085 CACAGGCGGGACTGGAGTGATGG - Intergenic
1142034513 16:87855116-87855138 CGCAGGAGGGATTGGGGACGCGG + Intronic
1142082797 16:88158783-88158805 TGCAGACAGGACTGGGGTCTGGG + Intergenic
1142103010 16:88285562-88285584 CACAGGTGGGCCTCGGGTCCTGG - Intergenic
1144827538 17:18114753-18114775 CCCAGGAGGGAGTGGGGTCCTGG - Intronic
1144849287 17:18235907-18235929 CACAGGCGGGAGTGGGGGCAGGG - Intronic
1146638218 17:34521555-34521577 AGCAGGCGGGGCTGGGGTGGGGG - Intergenic
1146791405 17:35752797-35752819 CACAGGCGGCCCTAGGGTCCTGG + Exonic
1147661912 17:42121263-42121285 CGCAGCCGGGGCCGGGGTCGGGG + Exonic
1147731882 17:42609280-42609302 CGAAGCCGGGCCTGGGGTCGTGG + Exonic
1151402246 17:73863380-73863402 CGCAGGCAAGAGTGGGGGCCTGG + Intergenic
1151509742 17:74550917-74550939 CGCAGGCCGGACCAGGGCCCTGG + Intergenic
1151821988 17:76501475-76501497 GGGAGGCGGGGCTGGGCTCCAGG + Intronic
1151985445 17:77540451-77540473 GGCAGTGGGGACAGGGGTCCGGG - Intergenic
1151985481 17:77540642-77540664 CGGTGGCAGGACTGGGGTCAGGG - Intergenic
1152197427 17:78925624-78925646 CGCAGCGGGGACCGGGGTCGGGG - Intergenic
1152541932 17:80981168-80981190 GGCAGCAGAGACTGGGGTCCCGG - Intergenic
1152687769 17:81703061-81703083 CGACGGCGGCACTGGGGGCCCGG + Intronic
1152852885 17:82648144-82648166 CTCGGGCGGGGCCGGGGTCCCGG + Intronic
1153985344 18:10345913-10345935 AGGAGGCAGGACTGGGCTCCTGG + Intergenic
1154450843 18:14474205-14474227 GCCTGGCAGGACTGGGGTCCTGG - Intergenic
1155957110 18:31963393-31963415 GGCAGTCAGCACTGGGGTCCAGG + Intergenic
1157589665 18:48828857-48828879 CGAAGGCGGGGCTGGGGGCTGGG - Intronic
1160464990 18:79069151-79069173 CGCAGGAGGCAGTGGAGTCCGGG - Intergenic
1160592412 18:79951763-79951785 CGCAGGCGGGGCCGGGAGCCGGG + Intergenic
1160744469 19:704152-704174 GGGAGGCGGGACTAGGGTGCAGG + Intergenic
1160861328 19:1238239-1238261 CGCAGGAGGGGGTGGGGTCCGGG + Intergenic
1161628461 19:5339863-5339885 CGGAGGGGAGACTGGGGTGCTGG + Intronic
1162126114 19:8500267-8500289 CACAGAAGGGACTGGGGGCCTGG - Intronic
1162925923 19:13930522-13930544 CTCTGGCGGGGCTGGGGGCCCGG - Exonic
1163137081 19:15319720-15319742 GGCAGGCTGGTCTGGAGTCCTGG - Intronic
1163604377 19:18266047-18266069 GGCAGGCGGGTCTGGGGTGAGGG + Exonic
1165293348 19:34906492-34906514 GGCAGAAGGGACTGGGGGCCTGG - Intergenic
1166094571 19:40530784-40530806 CGCGGGCGGGACTGAGGGGCCGG + Intronic
1166305470 19:41934838-41934860 GGGAGGAGGGACTGGGGGCCTGG + Intergenic
1166381539 19:42357580-42357602 CACAGGTGGGGCTGGGGACCGGG + Exonic
1166502667 19:43353379-43353401 GGGAGGAGGGACTGGGGGCCTGG + Intergenic
1166504367 19:43361889-43361911 GGTAGGAGGGACTGGGGGCCTGG + Intronic
1166525436 19:43507344-43507366 GGGAGGAGGGACTGGGGACCTGG - Intronic
1166525470 19:43507433-43507455 GGGAGGAGGGACTGGGGACCTGG - Intronic
1166699474 19:44874067-44874089 GGGAGGCGGGGCTGGGGGCCTGG + Intronic
1166794829 19:45419980-45420002 GGCAGGAGGGGCTGGGGGCCTGG - Intronic
1166982536 19:46639580-46639602 CGCAGCCGGGCCTGGGGCCCTGG - Intergenic
1167314298 19:48755028-48755050 GGAAGGAGGGGCTGGGGTCCTGG - Intronic
1167454339 19:49590687-49590709 CACAGCCGGGGCTGGGCTCCTGG - Exonic
1167630880 19:50625672-50625694 GGAAGGAGGGACTGGGGGCCTGG - Intronic
1167669175 19:50839582-50839604 GGGAGGAGGGGCTGGGGTCCTGG + Intergenic
1167690786 19:50982914-50982936 GGGAGGCGGGGCTGGGGGCCTGG - Intronic
1167738266 19:51310577-51310599 GGGAGGAGGGACTGGGGACCTGG + Intergenic
1167824748 19:51962048-51962070 CCCAGGAGGGACTGAGGTCATGG + Intergenic
1168092842 19:54096906-54096928 CGAAGGCCAGACTGGGGGCCGGG - Exonic
1168107718 19:54174504-54174526 GGGAGGAGGGGCTGGGGTCCTGG - Intronic
1168155424 19:54471516-54471538 CGCGGTGGGGACAGGGGTCCTGG - Intronic
1168238084 19:55076049-55076071 GGGAGGAGGGCCTGGGGTCCTGG + Intronic
1168245920 19:55113197-55113219 GGCAGGAGGGGCTGGGGGCCAGG - Intronic
1168250278 19:55137755-55137777 GGGAGGAGGGGCTGGGGTCCTGG - Intronic
1168266285 19:55225401-55225423 AGCAGGAGGGACGGGGGTCTGGG - Intergenic
1168277346 19:55285099-55285121 GGGAGGAGGGACTGCGGTCCTGG + Intronic
1168291997 19:55361602-55361624 GGGAGGAGGGACTGGGGGCCTGG - Intronic
1168292099 19:55361921-55361943 GGGAGGAGGGACTGGGGGCCTGG - Intronic
1168295881 19:55377199-55377221 GGGAGGAGGGGCTGGGGTCCTGG + Intronic
925347174 2:3179321-3179343 TGAAGGCGGGACAGGGGCCCTGG + Intergenic
926126916 2:10277628-10277650 GGCAGGCAGAAGTGGGGTCCAGG + Intergenic
927810285 2:26176531-26176553 GGCAGGAGGGACTGGGGCCAGGG + Intronic
929928561 2:46234655-46234677 CGGAGGCTGGGCAGGGGTCCTGG + Intergenic
933161035 2:79025653-79025675 TGTAGGCGGGACAGGGGTCATGG - Intergenic
934557836 2:95296811-95296833 GGCAGGCGGGACTGGGGCAGTGG + Intergenic
936512173 2:113157369-113157391 CGCAGGAGGGACTCGGTTTCCGG - Intronic
938480603 2:131658679-131658701 GCCCAGCGGGACTGGGGTCCTGG + Intergenic
940667978 2:156632392-156632414 AGCAGGAGGGACTGGGGGCATGG - Intergenic
947503311 2:230687573-230687595 TGCAGGTGGGACTGGGGTAAAGG + Intergenic
948423586 2:237874951-237874973 GGCAGGTGGGACTGGGACCCAGG + Intronic
948468758 2:238164376-238164398 CGAATGCGGGTGTGGGGTCCGGG - Intronic
948671852 2:239574043-239574065 TGCAGGCAGGACTGGGATGCTGG + Intergenic
1169506075 20:6213145-6213167 CTCAGCAGGGACTGGGGTACTGG + Intergenic
1172167589 20:32908424-32908446 CCCAGGAGGGAGTGGGGTCAAGG + Intronic
1174064330 20:47853661-47853683 CACAGGAGGGGCTGGGGACCAGG + Intergenic
1174204327 20:48827987-48828009 GGCGGGCGGGACTGGGGGCCGGG + Intergenic
1175182235 20:57156704-57156726 TGCAGGGGGGTCTGGGGCCCAGG + Intergenic
1175897859 20:62347298-62347320 TGGAGGCGGGACTGGGGAGCAGG + Intronic
1175943217 20:62547395-62547417 CGGAGGCGGGAAGGGGGGCCTGG - Intergenic
1176068819 20:63215741-63215763 CCCAGGCGGGACCGGGGTCTCGG - Intronic
1176197347 20:63843627-63843649 TGCAGGCAGGGCTGGGGTCTGGG - Intergenic
1178680372 21:34669084-34669106 CGCGGGCGAGATTGGGGTCCCGG + Intergenic
1179558526 21:42196044-42196066 CACAGGTGTGACTGGAGTCCTGG + Intergenic
1180211424 21:46297384-46297406 CGAAGGCGGGACCCGGCTCCGGG - Intronic
1180481750 22:15761147-15761169 GCCCGGCGGGACTGAGGTCCTGG + Intergenic
1180841158 22:18959521-18959543 CTGAGGCAGGACAGGGGTCCGGG - Intergenic
1180984955 22:19898707-19898729 TGCAGGAGGGCCTGGGGTCAAGG - Intronic
1181006574 22:20016514-20016536 CGGAGCCGGGACTGGGGGCGGGG - Intronic
1181060340 22:20279273-20279295 CTGAGGCAGGACAGGGGTCCGGG + Intronic
1181817364 22:25448510-25448532 CCCAGGTGGGAGTGGGGGCCAGG + Intergenic
1181857401 22:25791937-25791959 TGGAGTCGGGACTGGGATCCAGG + Intronic
1183357019 22:37365005-37365027 AGCAGGTGGGGCAGGGGTCCAGG + Intergenic
1184035425 22:41915591-41915613 CGAACGCTGGGCTGGGGTCCAGG + Intergenic
1184116805 22:42427031-42427053 AGCAGGCTGGATTTGGGTCCTGG - Intronic
1184121351 22:42452617-42452639 GGCAGGCGGCGCTGGGGCCCGGG - Intergenic
1184422816 22:44391710-44391732 TGCAGGTGGGGCTGGGGGCCAGG - Intergenic
1184655644 22:45940739-45940761 GGCTGGAGGGACTGGGGTGCAGG + Intronic
1185299406 22:50071849-50071871 AGCAGGCCGGGCTGGGGTGCTGG - Intronic
951520422 3:23606118-23606140 TGCAGGCTGGATTGGGGTCAGGG + Intergenic
958949435 3:100400856-100400878 CGGCGGCGGGACTGCGGGCCCGG - Exonic
961749289 3:129086005-129086027 TGCAGGGAGGAGTGGGGTCCAGG + Intergenic
968452569 4:682191-682213 AGCAGGAAGGGCTGGGGTCCTGG - Exonic
968514806 4:1011585-1011607 CGGGGGCGGGTCGGGGGTCCGGG + Intronic
968521425 4:1036299-1036321 TGCAGGCGGGTCTGAGGTGCAGG + Intergenic
968616318 4:1579249-1579271 CGCGGGCGGGGCCGGGGGCCGGG - Intergenic
968658939 4:1791101-1791123 AGGAGGAGGGACTGGGGACCAGG - Intergenic
969307906 4:6336217-6336239 CGCAGGCAGGCCTGGGGACTGGG - Intronic
969597680 4:8158329-8158351 CGCGCGGGGGCCTGGGGTCCGGG - Intronic
979536196 4:121823461-121823483 CGCTGGCGGTACTGAAGTCCGGG - Exonic
980713476 4:136600825-136600847 CCCAGGCTGGACTGGAGTGCAGG - Intergenic
985588527 5:753098-753120 GGCAGGCGGCGCTGGTGTCCTGG - Intronic
985603194 5:845537-845559 GGCAGGCGGCGCTGGTGTCCTGG - Intronic
985639607 5:1057578-1057600 CGTAGGCGGCGCTTGGGTCCTGG + Exonic
985652635 5:1113994-1114016 GGCAGCCGGCCCTGGGGTCCTGG - Intergenic
985685168 5:1278044-1278066 CATAGGCCAGACTGGGGTCCTGG + Intronic
986481207 5:8189899-8189921 CCCAGGCGTGACAGTGGTCCTGG + Intergenic
987369345 5:17179173-17179195 CTCAGGCTGGGTTGGGGTCCAGG + Intronic
996443013 5:123512650-123512672 CCCGGGTGGGGCTGGGGTCCCGG + Intronic
1001928763 5:175658203-175658225 CCCAGGCGGGCTTGGGGACCCGG + Intronic
1002574086 5:180161719-180161741 CGCAGGAGGGAGGGGGCTCCCGG - Intronic
1002817494 6:693741-693763 AGGAGGAGGCACTGGGGTCCGGG + Intergenic
1002931577 6:1638558-1638580 CTCAGGCAGGACTGGGCTCTGGG + Intronic
1006470878 6:34227838-34227860 CGCAGGGTGGCCTGGAGTCCTGG + Intergenic
1006642867 6:35497526-35497548 CGGAGCCGGGTCTGGGGCCCCGG - Intergenic
1006844335 6:37051878-37051900 CGCAGGAGGGACTGGCGTCCAGG + Intergenic
1013488532 6:110621235-110621257 CGCAGGTGGGGCTGGGGCCGGGG - Exonic
1013797319 6:113902172-113902194 CACAAGTGGGACTGAGGTCCAGG - Intergenic
1013836744 6:114342985-114343007 CGCAGGAGGGACCGGGTCCCTGG + Exonic
1016433130 6:144008391-144008413 CGCAGGCGGGGCTCGGGAGCCGG + Intronic
1019336362 7:484829-484851 GGGAGGCGGGACTGGAGCCCGGG + Intergenic
1019471617 7:1224278-1224300 TGCAGGCGGGACTCGGGCTCGGG + Intergenic
1019477798 7:1252324-1252346 CGCAGGCGGGGGTGGGGCCGTGG + Intergenic
1019540045 7:1547320-1547342 AGCAAGCTGGGCTGGGGTCCAGG - Intronic
1019989937 7:4683520-4683542 GGCAGCAGGGACTGGGGTCAAGG - Intronic
1020130248 7:5555420-5555442 CGGAGTGGGGACTGGGGTCAGGG - Intronic
1022103694 7:27184012-27184034 CCCGGCCGGGACTGGAGTCCCGG + Intronic
1022310740 7:29194292-29194314 GGGAGGCGGGACGGGGGACCGGG - Intronic
1022377536 7:29828689-29828711 CGCAGGCGGGACATGGCTACAGG - Intronic
1022723105 7:32957933-32957955 CGGCGGAGGGTCTGGGGTCCGGG - Intronic
1023054921 7:36283594-36283616 CTCAGGTGGGACTGAGGCCCAGG + Intronic
1023843626 7:44109522-44109544 AGCAGGCCAGCCTGGGGTCCAGG - Intronic
1023861571 7:44220303-44220325 AGCAGGCGGGGCGGGGGTCTCGG + Intronic
1024579831 7:50792988-50793010 CGGAGGCGGGACTGGGGCTGCGG - Intronic
1026593731 7:71716955-71716977 CTCAGCAGGGACTGGGCTCCTGG - Intergenic
1029535462 7:101154913-101154935 CACAGGCGGGAGCGGGGACCCGG + Intronic
1029563410 7:101319200-101319222 CACAGCCTGGTCTGGGGTCCAGG + Intronic
1031406732 7:121395965-121395987 CGCAGGCGGGACTGGGGTCCCGG - Intronic
1031922384 7:127611736-127611758 GGCAGGCAGCTCTGGGGTCCCGG - Intronic
1036701574 8:11016670-11016692 CGGAGGCGGGGCCGGGGGCCTGG - Intronic
1036788905 8:11704867-11704889 CGCCCTCGGGGCTGGGGTCCAGG + Intronic
1036789921 8:11710363-11710385 CGCAGGCGGGAGTGCGGGGCGGG + Intronic
1037725323 8:21478587-21478609 CACAGGGGGGTCTGGGGTCATGG - Intergenic
1038204939 8:25457827-25457849 CGCAGGCGGGAGCGGGGTCTCGG + Intronic
1038333426 8:26627690-26627712 CTCAGGCGGGACTGGGAACAGGG + Intronic
1045108767 8:98919812-98919834 AGCAGGTAGGACTGGGGACCAGG + Intronic
1047022962 8:120796025-120796047 CCCAGGTTGGACTAGGGTCCTGG + Intronic
1049218418 8:141418058-141418080 CCCCGGCGGGGCTGGGGTCCCGG - Intronic
1049996378 9:1038137-1038159 CGAAGGTGGGACTGGGATCAGGG + Intergenic
1057353626 9:94318926-94318948 GGCAGGTGGGTCTGTGGTCCTGG + Exonic
1057654125 9:96938666-96938688 GGCAGGTGGGTCTGTGGTCCTGG - Exonic
1059305350 9:113349596-113349618 CGGAGCCGGGGCCGGGGTCCGGG + Exonic
1059438524 9:114290090-114290112 CCCAGGCCGGAGGGGGGTCCAGG + Exonic
1060200874 9:121651369-121651391 CGCTGGCGGGATTGGGTGCCTGG + Intronic
1060479151 9:124007900-124007922 GGCAGGCGGGTCTGGGGCCAAGG + Intronic
1061588262 9:131582566-131582588 CCCAGGCGGGGCTGGGGGCCTGG + Intronic
1061674730 9:132209367-132209389 CGCAGGCGAGACTGGGCGCGGGG + Intronic
1062005832 9:134237988-134238010 CGCAGGGGGGACCAGGGACCAGG - Intergenic
1062216016 9:135390283-135390305 CCCAGGCAGGGCTGGGGCCCTGG + Intergenic
1062341451 9:136095418-136095440 CGGGGTCGGGGCTGGGGTCCGGG + Intergenic
1062414181 9:136439585-136439607 GGCTGGCGGGACTCGGGGCCCGG - Exonic
1186268558 X:7859251-7859273 GGCTGGTGGGACTGGGGTCTTGG - Intergenic
1189717665 X:43882352-43882374 GGCAGGCAGGACTGGGATCGAGG - Exonic
1190909397 X:54757785-54757807 CACAGGTGGGACTTGTGTCCTGG + Exonic
1192452819 X:71254111-71254133 AGCAGCCGGGACAGGGGTCGCGG + Exonic
1195544667 X:106101076-106101098 TGCAGGAGTCACTGGGGTCCAGG + Intergenic
1200140873 X:153902397-153902419 CGCTGGCAGGAGTGGGGGCCTGG + Intronic
1201617499 Y:15917809-15917831 TGAAGGAGGGACTGGGGTCATGG - Intergenic